A systematic approach for authentication of medicinal patrinia species using an integration of morphological, chemical and molecular methods

ABSTRACT Four common _Patrinia_ species, including _P. heterophylla_, _P. monandra_, _P. scabiosifolia_ and _P. villosa_, have been documented as herbal medicines with various clinical

applications, such as anti-cancer, anti-diarrhea and sedative. However, the authentication of medicinal _Patrinia_ species poses a problem, particularly with the processed herbal materials.

This study aimed to systematically authenticate the four medicinal _Patrinia_ species in the market using morphological and chemical characterization, as well as DNA markers. We found the

species identity authenticated by traditional morphologies were in good agreement with both chemical and molecular results. The four species showed species-specific patterns in

chromatographic profiles with distinct chemical markers. We also revealed the power of complete chloroplast genomes in species authentication. The sequences of targeted loci, namely _atpB_,

_petA_, _rpl2-rpl23_ and _psaI-ycf4_, contained informative nucleotides for the species differentiation. Our results also facilitate authentication of medicinal _Patrinia_ species using new

DNA barcoding markers. To the best of our knowledge, this is the first report on the application of morphology, chemical fingerprinting, complete chloroplast genomes and species-specific

Insertion-Deletions (InDels) in differentiating _Patrinia_ species. This study reported on the power of a systematic, multidisciplinary approach in authenticating medicinal _Patrinia_

species. SIMILAR CONTENT BEING VIEWED BY OTHERS DNA METABARCODING TO UNRAVEL PLANT SPECIES COMPOSITION IN SELECTED HERBAL MEDICINES ON THE NATIONAL LIST OF ESSENTIAL MEDICINES (NLEM) OF

THAILAND Article Open access 26 October 2020 DEVELOPMENT OF A DNA BARCODE LIBRARY OF PLANTS IN THE THAI HERBAL PHARMACOPOEIA AND MONOGRAPHS FOR AUTHENTICATION OF HERBAL PRODUCTS Article Open

access 10 June 2022 INTEGRATIVE MORPHOLOGICAL, PHYTOCHEMICAL, AND MOLECULAR IDENTIFICATION OF THREE INVASIVE AND MEDICINAL _REYNOUTRIA_ SPECIES Article Open access 18 February 2025

INTRODUCTION _Patrinia_ species have been traditionally used by Chinese medicine practitioners for various kinds of disorders, especially colon cancer. In recent years, _Patrinia_ species

have been documented with a number of research in phytochemistry and pharmacology which are related to its traditional usage1. Specific anti-cancer studies were also documented from various

research groups2,3. On the other hand, the herbs were usually adopted as food or supplements, hence they are widely cultivated in various provinces in China for various kinds of usage4.

According to _Flora Reipublicae Popularis Sinicae_ (FRPS), _Patrinia_ has ten species, three subspecies and two varieties. In _Flora of China_ (FOC), _Patrinia_ has been classified as eleven

species and three subspecies. Most of these species are believed to have medicinal value in general. However, only five _Patrinia_ species, _P. scabiosifolia_ Link, _P. scabra_ Bunge, _P.

heterophylla_ Bunge, _P. villosa_ (Thunb.) Juss. and _P. rupestris_ (Pall.) Juss., were documented in _Zhonghua Bencao_5 and _Zhongyao Da Cidian_6, and their herbal materials were named as

“Baijiang”, “Yanbaijiang” or “Mutouhui”. There is however no official record of its source plants and quality control requirement in the _Chinese Pharmacopoeia_ (2020)7. Moreover, the market

available _Patrinia_ materials have never been well identified. Hence, there is a need to verify the source species of the market available _Patrinia_ for their good quality control and

clinical application. When reviewing the preclinical research of _Patrinia_ species, three species were usually adopted in most studies mainly due to their regional usage and retails

availability. Firstly, _P. villosa_ seems to be the most frequently used and researched in _Patrinia_ history. The species was found to be used as traditional medicinal herbs, with various

clinical applications in anti-cancer, anti-diarrhea, sedative, etc. Specific application was recorded for its treatment in colorectal cancer by activating the PI3K/Akt signaling pathway8.

Secondly, _P. scabiosifolia_ has quite abundant records of its usage relating to cancer. Various compounds or raw extracts of the herbs have been tested against human carcinoma cell lines,

suggesting it to be a good anti-cancer herb9,10. Lignans, monoterpenes from the species also showed potential cytotoxic activities against human colon HCT-116 cells11. The herb was also

found to inhibit the growth of 5-fluorouracil-resistant colorectal carcinoma cells12. Thirdly, _P. heterophylla_ also has a number of records regarding its pre-clinical research. Its active

components, including phenylpropanoids, flavonoid, iridoids and coumarins, also possessed cytotoxic activities against different tumor cells13,14,15. It is important to note that the

identity of the medicinal _Patrinia_ species has always been confusing, and only few reports were found regarding their source materials authentication. One of the major concerns is the

inconsistency of botanical description and the phenotypic structures. Variations of the authenticating characters, such as involucral bract and leaf segments, are usually noticed. More

varying character states were found from the cultivated populations16. Moreover, medicinal _Patrinia_ were applied as processed materials, including decoction pieces and concentrated

granules. Hence, DNA fingerprints and chemical markers should be included as additional authentication tools to cope with various sample forms and increase the accuracy of authentication.

Chemical fingerprint is a reliable approach for TCM authentication as it supplements morphological evidence at another level of structural organization. Here, relations are investigated

between different classes of plants and the occurrence of specific substances or substance groups in plant tissues17,18. Thin layer chromatography (TLC) has been regarded as an excellent

tool for providing the chemical fingerprints. Compared to DNA fingerprinting and morphological identification, TLC is relatively simple, fast and inexpensive by fractionating complex plant

extracts for their respective fingerprints, therefore for easy perceiving similarities among different plant species19. Molecular authentication through DNA barcoding has been widely adopted

for medicinal plants. Universal barcode regions, including nuclear ribosomal Internal Transcribed Spacer (nrITS), plastid _rbcL_ and _psbA-trnH_ intergenic spacer, are commonly used.

However, their low differentiation power at species level20 and difficulties in amplification and sequencing21 have been reported. Meanwhile, the limited barcode sequences of _Patrinia_ on

NCBI GenBank were insufficient to allow meaningful comparisons and differentiation of these species. The study of Kim et al.22 attempted to differentiate four _Patrinia_ species namely _P.

scabiosifolia_, _P. villosa_, _P. saniculifolia_ Hemsl. and _P. rupestris_, using three universal barcode regions namely ITS2, _matK_ and _rbcL_. Their results showed that 22, 22, and 12

species-specific nucleotides in the amplicons of ITS2, _matK_ and _rbcL_, respectively, could differentiate the four species. The study of Moon et al.23 developed molecular markers using

random amplified polymorphic DNA (RAPD) genomic profiling, which the markers were designed for sequence characterized amplified region (SCAR). The above four species were successfully

distinguished from each other through multiplex-PCR SCAR assays based on the molecular weight of amplicons. Yet, both studies did not perform phylogenetic analysis to confirm the monophyly

of amplicon sequences and hence their species identity. Authentication of traditional Chinese medicines (TCM) by chloroplast genomes was achieved by our research group, Yik et al.24 and Ngai

et al.25 who authenticated Baihuasheshecao and Lingxiaohua, respectively. These studies confidently revealed the possibility of authenticating Baijiangcao (_Patrinia_ species) by using

complete chloroplast genomes. The objective of this study is to systematically authenticate the commonly retailed _Patrinia_ species using organoleptic structures, chemical fingerprints and

DNA fingerprints. Four _Patrinia_ species, namely _P. villosa_ subsp. _villosa_. _P. scabiosifolia_, _P. heterophylla_ and _P. monandra_ C. B. Clarke, were found available in the market.

Thirty-five samples were collected from various production sites in China, so the samples could well represent the current market status which truly reflect the TCM classes used by the

consumers. It is believed that a comprehensive documentation of the marketable Patriniae Herba would be important for their quality control and standardization. RESULTS MORPHOLOGICAL

AUTHENTICATION The sample materials were well classified into 4 species, each has one representative specimen as reference voucher. The selected specimens were found to have critical

characters that are consistent with the description of FRPS and FOC. To further confirm their identities, these plant structures were found to be matched with the authentication records

given by other research groups26,27. The confirmed structural description with some key photos of the four species (Fig. 1) are given as below. (A) _PATRINIA HETEROPHYLLA_ BUNGE (M. C. LI

089) Bracteole 2-veined (Fig. 1a), ~ 6 mm; peduncle densely hispidulous (Fig. 1b); involucral bract in linear segment; upper bract linear (Fig. 1c); leave papery; basal leaves with two pairs

of segments (Fig. 1d). (B) _PATRINIA MONANDRA_ C. B. CLARKE (M. C. LI 103) Bracteole 2-veined (Fig. 1e), ~ 5 mm; peduncle densely hirsute (Fig. 1f); involucral bract ~ 8.5 cm (Fig. 1g); one

longer stamen exserted (Fig. 1h). (C) _PATRINIA VILLOSA_ (THUNB.) JUSS. SUBSP. _VILLOSA_ (M. C. LI 403) Bracteole 2-veined; peduncles densely hirsute (Fig. 1i); involucral bract

ovate-lanceolate (Fig. 1j) to linear; basal leaves rosulate; cauline leaves no segment (Fig. 1k); corolla white (Fig. 1l). (D) _PATRINIA SCABIOSIFOLIA_ LINK (M. C. LI 083) Peduncles densely

hirsute abaxially (Fig. 1m); bracteole reduced (Fig. 1n). CHEMICAL ANALYSIS To minimize unpredictable statistical bias in chemical fingerprint analysis, a total of 35 sample materials were

performed. The R_f_ values were calculated using visionCATS software under UV light after spraying with a 10% sulfuric acid in ethanol. The use of UV 366 nm was found to be the most suitable

for visualizing the compounds compared to ultraviolet radiation at 254 nm and white light. The chromatographic profiles indicated that all sample constituents were clearly separated without

any tailing and diffuseness. In general, the four different species were different in content and type of chemical components. The TLC fingerprints of _P. villosa_ subsp. _villosa_, _P.

scabiosifolia_, _P. heterophylla_ and _P. monandra_ are shown in Fig. 2. Distinct differences were observed among the chromatographic profiles at species level. The TLC fingerprint showed

that there were four benchmark highlight blue spots S2, S3, S4 and S6, (R_f_ value 0.62, 0.51, 0.40 and 0.25, respectively) represented well the characteristics of _P. villosa_ subsp.

_villosa_. However, these four spots are absent in _P. scabiosifolia_. Further data analysis revealed that the spot S3 (R_f_ value 0.51) was the strongest spot in the TLC profile and only

appeared in both _P. monandra_ and _P. villosa_ subsp. _villosa_, but the intensity was significantly lighter in _P. monandra_. These differences in the intensities of the spots representing

the major compounds were evident within samples from different species. Similarly, the blue-green spot S1 (R_f_ value 0.81) was detected in _P. heterophylla_ and _P. scabiosifolia_, but

absent in _P. villosa_ subsp. _villosa_. Therefore, the spot S1 should be unique to _P. scabiosifolia_ and _P. heterophylla_. Interestingly, both the results of morphological identification

and DNA fingerprinting indicated the species identity of sample M. C. Li 082 and M. C. Li 083 as _P. scabiosifolia_, but the TLC analysis revealed that these two samples lacked the spot S5

(R_f_ value 0.31), and the intensity of the spots S1 and S5 were also significantly weaker than other _P. scabiosifoilia_ samples. Considering that the sample comes from different production

sites, the potential reasons for this inter-individual variation could be caused by various factors such as genetic variability, environmental factors, and random chance. The results of TLC

chromatograms for four different _Patrinia_ species are summarized in Table 1. In conclusion, by examining the presence or absence of the spots S1–S6 in the TLC profile, as well as the

intensity of the spot S3, we can eventually differentiate and identify these four different species. MOLECULAR ANALYSIS AMPLIFIABILITY OF PRIMERS Among the six pairs of designed primer, four

pairs namely _Pat-rpl2-rpl23-2_, _Pat-petA_, _Pat-psaI-ycf4_ and _Pat-atpB-1_, could successfully amplify targeted sequences from all four authenticated specimens. In contrast, the primer

pairs _Pat-rpl2-rpl23-1_ and _Pat-atpB-2_ could amplify sequences from all authenticated specimens except the one of _Patrinia heterophylla_ (M. C. Li 089). For fair comparison, we discarded

these two primer pairs for the subsequent amplification and analysis of the thirty-three testing samples. The two universal primer pairs, namely ITS-S2F/ITS-S3R and psbAF/trnHR, were able

to amplify sequences from both the four authenticated specimens and the thirty-three testing samples. The differentiation power of both barcode regions universal for land plants and the

targeted chloroplast regions for the genus _Patrinia_ are discussed below. IDENTIFICATION OF SPECIES-SPECIFIC SNPS AND INDELS Species-specific variable nucleotides, including Single

Nucleotides Polymorphisms (SNPs) and Insertion-Deletions (InDels), were identified from all studied taxon except _P. monandra_ in the targeted chloroplast regions. For _P. villosa_ subsp.

_villosa,_ a species-specific insertion in 24 bp (3′ GAAGGGGTATGTTATTATTTTATT 5′) was found in the intergenic spacer of _psaI_-_ycf4_ at the alignment position of 185th–208th bp (Table 2).

Meanwhile, a species-specific substitution as cytosine (C) was found in the intergenic spacer of _rpl2-rpl23_ at the 173rd alignment position, where other studied taxa shared the nucleotide

guanine (G). For _P. scabiosifolia_, a total of six species-specific substitutions were found in the targeted chloroplast regions. One substitution as G was found in the intergenic spacer of

_psaI-ycf4_ at the 89th alignment position where other studied taxa shared the nucleotide thymine (T). Another substitution as adenine (A) was notified in the intergenic spacer of

_rpl2-rpl23_ at the 141st alignment position where other species shared the nucleotide T. In the same region, three other substitutions as C were found at the alignment positions of 336th,

337th and 362nd, where other species shared the nucleotides G, T and T, respectively. The last substitution as C was found in _petA_ at the 221st alignment position, where other species

shared the nucleotide T. For _P. heterophylla_, two substitutions as C and G were respectively found in _atpB_ at the alignment position of 212th and in _petA_ at the alignment position of

194th, whereas other species shared the nucleotide A and T, respectively. For _P. scabra_, three substitutions were found. In _atpB_, the substitution A was found in the alignment position

of 83rd while other species shared the nucleotide G. At the alignment position 548th in _petA_, the substitution T of _P. scabra_ was observed, in opposite to the nucleotide C in other

species. In addition, the substitution G was found in _psaI-ycf4_ at the alignment position of 162nd whereas other species shared the nucleotide A. For _P. villosa_ subsp. _punctifolia_, a

total of five substitutions were found in the region _atpB_ and _rpl2-rpl23_. One substitution G was found in the _atpB_ at the alignment position of 41st, in opposite to the nucleotide A in

other species. The other four substitutions, namely G, G, T and T, were respectively found in _rpl2-rpl23_ at the alignment position of 165th, 264th, 265th and 266th, whereas other species

shared the nucleotides C, T, A and A, accordingly. Although there were no species-specific SNP or InDel observed in _P. monandra,_ there is one “substitution-like” nucleotide (as A) at the

very beginning of the _petA_ alignment at the 24th position. Yet, at this early beginning of alignment, a few accessions of other _Patrinia_ species showed no nucleotide, as a result we

cannot regard this as a SNP. The above SNPs and InDels, which differentiated the six taxa from each other, could be used as molecular diagnostic markers, particularly the long insertion of

_P. villosa_ subsp. _villosa_ in _psaI_-_ycf4_. MONOPHYLY OBSERVED IN SINGLE LOCUS AND MULTI-LOCI PHYLOGENETIC TREES Poor differentiation powers were seen from universal barcode regions of

land plants namely ITS2 and _psbA-trnH_. In the Neighbour-Joining (NJ) tree constructed by ITS2, the accessions of different species clustered into multiple clades (Supplementary Fig. S1).

The species resolution of _psbA-trnH_ was low (as 33.3%; Table 3), yet the monophyly of _P. heterophylla_ and _P. scabra_ were confirmed in NJ tree (Supplementary Fig. S2). The combination

of ITS2 and _psbA-trnH_ were even worse than the single locus _psbA-trnH_, since only the cluster of _P. scabiosifolia_ was monophyletic (Supplementary Fig. S3), suggesting these two

universal regions are unable to authenticate _Patrinia_ samples down to species-level. Targeted chloroplast regions which were amplified using the designed primers showed improvement in

differentiation power according to different loci combinations. The differentiation power of single locus region varies. The most powerful one was _petA_ as all six taxa formed monophyletic

clades in the NJ tree (Supplementary Fig. S4), with the greatest (100%) discrimination success rate (Table 3). It was noticed that _atpB_ was able to differentiate _P. heterophylla_ and _P.

scabra_ from the others (Supplementary Fig. S5), giving 33.3% discrimination rate. The region _psaI-ycf4_ also showed 33.3% discrimination success rate, that _P. scabiosifolia_ and _P.

villosa subsp. punctifolia_ were distinguished from the others. Interestingly, although a species-specific diagnostic marker of _P. villosa_ subsp. _villosa_ in 24 bp was found in this

region, the subspecies was clustered with _P. monandra_ in a large clade (Supplementary Fig. S6). Monophyletic clades of _P. scabiosifolia_, _P. villosa_ subsp. _villosa_ and _P. villosa_

subsp. _punctifolia_ were observed in the NJ tree of _rpl2-rpl23_ (Supplementary Fig. S7), giving half (50%) discrimination success rate contributed by the twenty SNPs in this region, with

nine of them being species-specific. Among the six two-loci combinations, _atpB_ + _petA_ (Supplementary Fig. S8) and _petA_ + _rpl2-rpl23_ (Supplementary Fig. S9) showed the highest

discrimination success rate (100%). Distinct monophyletic clades of the six studied taxa were observed in the NJ trees constructed by these two combinations. It was contributed by 16 and 32

informative variable nucleotides in the combination _atpB_ + _petA_ and _petA_ + _rpl2-rpl23_, respectively, in which 6 and 12 of these nucleotides were species-specific. The other 4

two-loci combinations (Supplementary Figs. S10–S13) showed 33.3–83.3% discrimination success rate. Among the four three-loci combinations, _petA_ + _psaI-ycf4_ + _rpl2-rpl23_ (Supplementary

Fig. S14), _atpB_ + _petA_ + _rpl2-rpl23_ (Supplementary Fig. S15) and _atpB_ + _petA_ + _psaI-ycf4_ (Supplementary Fig. S16) showed the highest discrimination success rate (100%). The

combination _atpB_ + _psaI-ycf4_ + _rpl2-rpl23_ (Supplementary Fig. S17) showed 83.3% discrimination success rate as the accessions of _P. monandra_ and _P. villosa_ subsp. _villosa_ were

clustered into one big clade in the NJ tree. When all four regions were concatenated for NJ tree reconstruction, all six taxa were clearly divided into distinct monophyletic clades in the NJ

tree (Fig. 3 and Supplementary Fig. S18). The topology of it was similar to those with 100% discrimination rate, namely _petA_ + _rpl2-rpl23_, _atpB_ + _petA_ + _psaI-ycf4_, _atpB_ + 

_psaI-ycf4_ + _rpl2-rpl23_, _atpB_ + _petA_ + _rpl2-rpl23,_ but not _petA and atpB_ + _petA_ which the cluster of _P. heterophylla_ and _P. scabra_ was not sister to _P. scabiosifolia_. To

explore the possible barcoding gaps, another genetic-distance based method Unweighted Pair Group Method with Arithmetic mean (UPGMA) was employed for phylogenetic reconstruction. The single

locus _petA_ showed six monophyletic clades for each taxa in the UPGMA tree (Supplementary Fig. S19), yet the topology was different from the NJ tree as the clade consisting of _P.

heterophylla_ and _P. scabra_ became the basal one. The resolution of _atpB_ had been increased in UPGMA tree (Supplementary Fig. S20) since _P. scabra_, _P. heterophylla_ and _P. villosa_

subsp. _punctifolia_ were distinguished from the rest _Patrinia_. In the UPGMA tree of _rpl2-rpl23_ (Supplementary Fig. S21), monophyletic clade of _P. monandra_ was formed in contrary to

the NJ tree, however _P. scabra_ was still nested in the cluster of _P. heterophylla_. The resolution of _psaI-ycf4_ was also improved in UPGMA tree (Supplementary Fig. S22) since all

_Patrinia_ taxa formed monophyletic clades, except _P. villosa subsp. villosa_ and _P. monandra_ were clustered into a large single clade. The UPGMA tree of four-loci combination

(Supplementary Fig. S23) shared similar topology with the NJ tree that the six studied taxa were also in monophyly. In addition to genetic-distance based method, character-based method as

Maximum Likelihood (ML) was also employed. In the ML tree of _petA_ (Supplementary Fig. S24), the clade of _P. monandra_ was nested into the one of _P. villosa_ subsp. _villosa_, while the

rest taxa could be distinguished from each other. Paraphyly of four _Patrinia_ taxa was observed in the ML tree of _atpB_ (Supplementary Fig. S25), only _P. heterophylla_ and _P. scabra_

could form monophyletic clades, similar to the NJ tree. The resolution of the ML tree of _rpl2-rpl23_ (Supplementary Fig. S26) was comparable to the NJ tree since the monophyly of _P.

scabiosifolia_, _P. villosa_ subsp. _villosa_ and _P. villosa_ subsp. _punctifolia_ were observed, although the topology was slightly different as the cluster of _P. heterophylla_ and _P.

scabra_ became the basal one. The ML tree of _psaI-ycf4_ (Supplementary Fig. S27) was also similar to the NJ tree since only _P. scabiosifolia_ and _P. villosa_ subsp. _punctifolia_ could be

distinguished from the rest. The ML tree of four-loci combination (Supplementary Fig. S28) showed lower resolution than the NJ tree since _P. monandra_ could not form monophyletic clade and

clustered with _P. villosa_ subsp. _villosa_. DISCUSSION Based on the 35 samples collected from different provinces in China, four species were identified including _P. villosa_ (Thunb.)

Juss. subsp. _villosa_, _P. scabiosifolia_ Link, _P. heterophylla_ Bunge and _P. monandra_ C. B. Clarke. The first three species are also commonly recorded as medicinal species in _Patrinia_

literatures. Moreover, the key morphological characters (Fig. 1) of the selected samples from the same species were consistent with the descriptions in the floras, showing stable phenotypic

variations. The materials of these four species collected in this study were treated as reliable raw materials for further study in chemistry and DNA analysis. However, morphological

variations of non-key characters were also observed among species and individuals, that required additional analyses other than morphological means for accurate authentication. Chemical

method using thin layer chromatography (TLC) was adopted as the first consolidation of the species identify, since not all herbal forms show sufficient characters for morphological

authentication. The TLC technology, regarded as one of the fundamental and widely used chromatographic analysis methods, has been consistently applied in the chemical analysis of herbal

medicines. The analytical approaches were well adopted by the Chinese Pharmacopeia owing to its simplicity, sensitivity and high throughput. With advancements in TLC equipment and

automation, the fingerprinting method shows great potential for identifying and characterizing different species of plants. Our work has also successfully revealed the distinct differences

among the chemical fingerprints of _P. villosa_ subsp. _villosa_, _P. scabiosifolia_, _P. monandra_, and _P. heterophylla_. These characteristic TLC profiles of plant species not only aid in

their identification and quality control, but also provide information for further identification of chemical marker compounds specific to each species. Therefore, based on the different

TLC fingerprints of _Patrinia_ (as shown in Table 1), future research will focus on isolating and identifying chemical markers such as S1, S3, and S5, which can be used to differentiate and

identify the four species of _Patrinia._ Repeatedly analysis of the TLC profiles showed the five spots with different R_f_ values were mostly consistent in most samples of the same species,

which could be adopted as authenticating chemical fingerprints. Compared with DNA authentication, time of developing TLC profile was comparatively shorter, which is about two-third less for

the same quantity of samples. However, the composition of phytochemistry is prone to be affected by various factors, including growing stages, medicinal parts used, growth environment and

post-harvest processing. These factors contributed to the observed inconsistency in the spot intensity as in our results (Fig. 2), that two _P. scabiosifolia_ (M. C. Li 082 and 083) samples

showed comparatively weaker intensity of spot S1 and S5, while one _P. heterophylla_ (M. C. Li 476) showed greater intensity of spot S5 which were even absent in other samples of _P.

heterophylla_. Moreover, if two herbs are closely related, their chemical profiles of great similarity could not be differentiated. In order to develop a platform of accurate authentication,

DNA analysis was further employed. The time cost of DNA analysis was greatly increased by a list of sequential procedures, i.e. DNA extraction, PCR amplification, purification of PCR

products, Sanger sequencing and nucleotide analyses including SNP and InDel analysis and phylogenetic tree reconstruction. The completion of all procedures could take about two to three

weeks. Yet, species identity could be reinforced critically by the species-specific SNPs and InDels, as well as the monophyly of singe-species clades in phylogenetic tree. More importantly,

this molecular evidence is less influenced by environmental factors when comparing to chemical markers. The integration of the three authentication methods by morphological, chemical and

molecular evidence contributed to an accurate authentication platform of _Patrinia_ herbal medicines. In this study, the application of complete chloroplast genomes in authenticating plant

species was fully demonstrated. The method and results are valuable in DNA barcoding authentication, particularly for the plant taxa that are hardly differentiated down to species-level by

using universal barcode regions. As in the case of _Patrinia_ species, the universal barcode regions were not useful in differentiating the targeted four species through DNA barcoding. In

this study, although eighteen variable nucleotides including eight species-specific nucleotides were identified in the universal barcode region ITS2, it showed no resolution in species

discrimination. It is contrasting to the work of Kim et al.22 that 22 species-specific nucleotides were found in this nuclear region. The reason could be probably due to different primer

pairs were used and different species were studied. The primer pairs ITS-S2F and ITS-S3R were used in this study, while ITS-S2F and ITS4 were adopted in the study of Kim et al.22. Besides,

_P. heterophylla_, _P. monandra_, _P. scabra_ and _P. villosa_ subsp. _punctifolia_ were included in this study, but not _P. saniculifolia_ and _P. rupestris_ in the study of Kim et al.22.

When using the targeted regions based on the full alignment of the complete chloroplast genomes, the sequence of amplicons could truly help in species differentiation, although the

discrimination success rate of each targeted regions varies. It is suggested to use _petA_ as the key barcode region as this single region has genetic information to differentiate all six

studied taxa into monophyletic clades. When combining two loci for phylogenetic reconstruction, both combination of _atpB_ + _petA_ and _petA_ + _rpl2-rpl23_ could increase the

discrimination success rate up to 100%, further revealing the importance of _petA_ in species authentication. When three loci were used for phylogenetic reconstruction, the combination

_atpB_ + _petA_ + _rpl2-rpl23, petA_ + _psaI-ycf4_ + _rpl2-rpl23 and atpB_ + _petA_ + _psaI-ycf4_ provided the best discrimination success rate (100%). So, if limited resources are obtained,

it is suggested to simply use the single locus _petA_ for differentiating _Patrinia_ species. However, 2 to 3 loci should be considered in order to provide better resolution. Particularly,

the species-specific insertion in 24 bp (3′ GAAGGGGTATGTTATTATTTTATT 5′) of _P. villosa_ subsp. _villosa_ is highly informative. Although having the same discrimination success rate as 33.3%

with _psaI-ycf4_, the region _atpB_ is not preferred as only 4 informative variable nucleotides were found. The region _rpl2-rpl23_ has twenty informative variable nucleotides in which nine

of them are species-specific, contributing to the moderate discrimination success rate as 50%. Therefore, _psaI-ycf4_ and _rpl2-rpl23_ should be considered as auxiliary markers for better

resolution and greater bootstrap values. The topological differences between NJ, UPGMA and ML trees of the four-loci combination were probably caused by the lack of species-specific

nucleotides in distinguishing _P. monandra_ from the others. It was obvious that monophyletic clade of _P. monandra_ could not be formed in the ML tree. Future study in capturing

species-specific chloroplast SNPs and InDel of _P. monandra_ and other _Patrinia_ species would be helpful in increasing the resolution of phylogenetic analyses. Comparing to the RAPD

genomic profiling and SCAR markers in the study of Moon et al.23, the utilization of complete chloroplast genomes in authenticating medicinal _Patrinia_ is relatively reliable and stable.

Firstly, heavy work in screening suitable markers and primers were required in Moon’s study. Forty-seven out of eighty-six Operon primers produced distinct RAPD profiles, with twenty-eight

primers showing polymorphic fragments. Based on forty-six species-specific amplicons, forty-three SCAR primer pairs were designed and eight of them were selected to capture the

species-specific amplicons. In contrast, primer design and selection using chloroplast genome is more convenient and less labor intensive. Demonstrated in this study, three divergence

hotspots were identified on chloroplast genomes alignment, and 4 out of 6 primer pairs were screened through amplification trial. Secondly, the multiplex-SCAR assay was restricted by the

spectrum of amplicon size, as the primer sets had been chosen to visualize the differentiation in species-specific size. In our study, the amplicons were simply purified from agarose gel for

sequencing, phylogenetic tree reconstruction and identification of informative nucleotides. Thirdly, the stability and specificity of RAPD profiling is affected by PCR conditions. In

contrast, all PCR amplifications for targeted chloroplast regions were conducted under the same condition, with relatively low annealing temperature as 40 °C that is less specific, yielded

strong bands at desired amplicon size for most of the samples as shown in our electrophoresis gels (Supplementary Fig. S29–S36). In addition, chloroplast genomes allow us to design specific

primers capturing DNA fragments originated from chloroplast, and hence avoiding fungal contamination which occurs in ITS. In summary, this study truly reflects the power of integrating plant

taxonomy, chemical fingerprinting and DNA analysis. It is hard to start any authentication without knowing the name of the plants and the DNA sequences. Traditional morphological

identification of plant species is the most efficient and direct way of authentication, but phytochemicals would become important markers when morphology or genomic DNA are not available.

When samples quality is good enough for DNA extraction, the power of complete chloroplast genomes was demonstrated in breaking through the limitation of universal barcode regions. This study

is also the first time to discover long fragment of species-specific InDels in the chloroplast regions for species differentiation of _Patrinia_. In conclusion, the three aspects of

authentication methods would complement to each other to cope with various samples forms and states for better quality control of Chinese medicines. METHODS MORPHOLOGICAL AUTHENTICATION

Fresh samples of _Patrinia_ species available in the markets were purchased from various provinces in China (Table 4). All fresh parts with flowers or fruits were used to prepare herbarium

specimens. The identity of each sample was morphologically confirmed by studying the characters of the bracteole, peduncle indumentum, involucral bract, leave texture, basal or cauline leave

arrangement, stamen structure and corolla color. All authenticated samples after standardized specimen processing methods were deposited in the Shiu-Ying Hu Herbarium (herbarium code: CUHK)

as voucher specimens with collector numbers. Materials for chemical and molecular analysis were reserved for each specimen. The samples were well classified into 6 taxa. Among all samples,

four specimens with well preserved and clear structures were adopted as our reference specimens (authenticated specimens in Table 4). The collector numbers are given as below: _Patrinia

heterophylla_ Bunge (M. C. Li 089) _Patrinia monandra_ C. B. Clarke (M. C. Li 103) _Patrinia scabiosifolia_ Link (M. C. Li 083) _Patrinia villosa_ (Thunb.) Juss. subsp. _villosa_ (M. C. Li

403) CHEMICAL AUTHENTICATION For each of the herbal samples, the test solution was prepared by extracting 2 g dried and pulverized herb with 20 ml methanol under ultrasonic condition at room

temperature (approximately 21 °C) for 60 min, followed by filtration. The filtrate was then evaporated to dryness under reduced pressure at 50 °C. The extract was dissolved in 5 ml of

methanol and was used for TLC analysis on silica gel 60 F254 TLC plates (20 cm × 10 cm, Merck, Germany). Extracts (2 μL) were applied to the plates as 8 mm bands using the CAMAG automatic

TLC Sampler 4 (ATS4, Muttenz, Switzerland), development to a distance of 8.5 cm up the plate was performed in a TLC developing chamber. A mixture of ethyl acetate: methanol: water (8:1:1,

v/v, upper layer) was used as the developing solvent system. The plate was then heated on a TLC plate heater (CAMAG, Muttenz, Switzerland) at about 105 °C after spraying with the 10 %

solution of sulfuric acid in ethanol until the color of the spots appeared distinctly. High-definition images of the TLC plate were captured using a Visualizer 3 (CAMAG, Muttenz,

Switzerland) linked with WinCATS software28 under UV light (λ = 366 nm). MOLECULAR AUTHENTICATION SLIDING WINDOW ANALYSIS AND PRIMER DESIGN The nine accessions of _Patrinia_ complete

chloroplast genomes (Supplementary Table S1) available on NCBI GenBank were downloaded for alignment. MAFFT version 729 were used to align the chloroplast genomes. Sliding window analysis

was performed using DNA Sequence Polymorphism (DnaSP) version 6.12.0330 for the calculation of nucleotide diversity values (Pi) from the aligned chloroplast genomes, in which the window

length and the step size were set to 600 bp and 200 bp, respectively. The result was then visualized in a line chart (Fig. 4). Hotspot regions were identified with a threshold value Pi =

0.05. The loci above this value were considered as potential candidates for species differentiation. Three hotspots were identified, namely _atpB_ (alignment position: 57,125–58,621 bp),

_psaI-ycf4_-_petA_ (66,232–69,774 bp) and _rpl2-rpl23_ (94,020–95,295 bp). All the hotspot regions were located in Large Single Copy (LSC). Since the hotspot _psaI-petA_ in over 3500 bp was

too long for PCR amplification, only the hypervariable regions were targeted, resulted in two loci as _psaI_-_ycf4_ (66,232–67,096 bp) and _petA_ (69,520–69,774 bp) were considered for

primer design. According to the hotspot regions, six pairs of primers were designed (Table 5) to capture the hypervariable positions with differentiating power. Since the intergenic spacer

between the protein-coding gene _rpl2_ and _rpl23_ exceed 1200 bp which was not beneficial for PCR amplification, two pair of primers were designed to amplify two separated fragments (630 bp

and 460 bp) of this locus. The same treatment was also performed for the loci _atpB_ since this protein-coding gene exceeds 1400 bp. DNA EXTRACTION About 50 mg of each silicon-dried leaf

sample (Table 4) were taken for DNA extraction (Supplementary Table S2). Weighed samples were placed in 2 mL Precellys Hard tissue grinding MK28 (Bertin Corp., Maryland, USA), and

homogenized by Precellys Evolution Tissue Homogenizer (Bertin Technologies, Montigny-le-Bretonneux, France) using hard tissue mode. Total genomic DNA of all studied samples were extracted

using i-genomic Plant DNA Extraction Mini Kit (iNtRON Biotechnology, Daejeon, Korea) following the instructions of the manufacturer. The quality and quantity of extracted DNA were assessed

by 1.5 % agarose gel electrophoresis and NanoDrop Lite Spectrophotometer (Thermo Fisher Scientific, Massachusetts, USA), respectively. PCR AMPLIFICATION, AGAROSE GEL ELECTROPHORESIS AND DNA

SEQUENCING PCR amplification using both designed and universal primer pairs (Table 5) was firstly conducted for the samples of the four authenticated specimens representing _P.

scabiosifolia_ (M. C. Li 083), _P. villosa_ subsp. _villosa_ (M. C. Li 403), _P. monandra_ (M. C. Li 103) and _P. heterophylla_ (M. C. Li 089) (Table 4). After assessing the amplifiability,

the primer pairs were used to amplify the target sequences from thirty-three testing samples collected from various locations in the mainland China. These samples include six samples of _P.

heterophylla_, six samples of _P. monandra_, eight samples of _P. scabiosifolia_ and eleven samples of _P. villosa_ subsp. _villosa_. In addition, to test the amplifiability on other

_Patrinia_ taxa, a sample of _P. scabra_ Bunge and one of _P. villosa_ subsp. _punctifolia_ H. J. Wang were adopted for PCR amplification using the selected primer pairs. Extracted total

genomic DNA of each sample were amplified using GoTaq® G2 Flexi DNA Polymerase (Promega, Wisconsin, USA). In each 30-μL reaction, 6 μl 1X Green GoTaq® Flexi Buffer, 3 μl MgCl2 (2.5 mM), 0.6

μl Promega dNTPs mix (0.2 mM), 1.5 μl Forward Primer (500 nM), 1.5 μl Reverse Primer (500 nM), 0.2 μl GoTaq polymerase (1 U/μl), 1 μL template DNA and 16.2 μl double-distilled water were

included. Thermocycling procedures were undertaken in Applied Biosystems VeritiPro 96-Well Thermal Cycler (Thermo Fisher Scientific, Massachusetts, USA), started with an incubation at 95 °C

for 4 minutes, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 40 °C (or 45°C for ITS2 and _psbA-trnH_) for 30 s and elongation at 72 °C for 40 s, and finished by a

final extension at 72 °C for 4 min. PCR products were kept at 12 °C or stored at 4 °C refrigerator until being subjected to gel electrophoresis in 1.5 % agarose gels for purification.

QIAquick Gel Extraction Kit (Qiagen Co., Hilden, Germany) were used to purify PCR products following manufacturer’s instructions. Purified PCR products were sent to Tech Dragon Limited

(Shatin, Hong Kong, China) for Sanger sequencing using Applied Biosystems 3730xl DNA Analyzer. Bidirectional sequences were assembled using CodonCode Aligner (Centerville, Massachusetts,

USA)31. All assembled sequences were uploaded to NCBI GenBank, with the accession number of OR712158 to OR712225, PP277662 to PP277698 and PP280905 to PP281021 (Supplementary Table S3).

Low-quality nucleotides with QV value below 30 at the two ends were discarded. PHYLOGENETIC ANALYSIS Single locus and multiple-loci combination of sequences were used for phylogenetic

analysis to assess their differentiation power down to species level. The sequences were firstly aligned using MAFFT version 729, and then being adopted for phylogenetic tree construction

using MEGA X version 10.2.532. The best-fit model with the lowest Bayesian Information Criterion (BIC) was selected. To explore the possible barcoding gaps of the four targeted chloroplast

loci, genetic-distance based methods namely Neighbour-Joining (NJ) and Unweighted Pair Group Method with Arithmetic mean (UPGMA), as well as character-based method i.e. Maximum Likelihood

(ML), were adopted for phylogenetic analysis of the studied _Patrinia_ species. For the multiple-loci combination, the amplicon sequences of each specimen were accordingly concatenated into

a single sequence, which were then aligned using MAFFT version 729. NJ, UPGMA and ML trees were constructed from single locus and four-loci combinations, while only NJ trees were constructed

from two-loci and three-loci combinations. To root the trees, _Valeriana officinalis_ L. from the family Caprifoliaceae was selected as an outgroup species. Fragments of ITS2 and all

chloroplast regions (_psbA-trnH_, _atpB_, _petA_, _rpl2-rpl23_ and _psaI-ycf4_) were extracted from the NCBI accessions ON685480 (3713 bp) and NC_045052 (complete chloroplast genome in

151,505 bp33), respectively. To further prove the authentication power by this method, the two additional well-authenticated _Patrinia_ taxa, _P. scabra_ Bunge (M. C. Li 483) and _P.

villosa_ (Thunb.) Juss. subsp. _punctifolia_ H. J. Wang (M. C. Li 484), were included in the phylogenetic analysis. Informative variable nucleotides, including species-specific and

non-species-specific nucleotides, were manually identified using BioEdit34 based on the unrooted alignments of each locus (Table 3). These variable nucleotides were classified as

Single-Nucleotide Polymorphisms (SNPs) and Insertions–deletions (Indels). The number of variable nucleotides of multi-loci combinations were then calculated. Discrimination success rates was

calculated by dividing the number of monophyletic clades containing single taxon in the NJ tree over the total number of studied _Patrinia_ taxon (as 6) times 100%. DATA AVAILABILITY All

DNA barcode sequences amplified from the studied _Patrinia_ species with voucher specimens were submitted to and available in the GenBank Database (https://www.ncbi.nlm.nih.gov/nuccore).

Accession numbers: OR712158–OR712225, PP277662–PP277698 and PP280905–PP281021. The accession number corresponds to the six specified regions for each specimen were listed in Supplementary

Table S3. REFERENCES * Meng, L. _et al._ Chemical constituents and pharmacological effects of genus _Patrinia_: A review. _Curr. Pharmacol. Rep._ 6, 380–414.

https://doi.org/10.1007/s40495-020-00240-7 (2020). Article  CAS  Google Scholar  * Chen, X., Yan, X. & Guo, L. Inhibitory effect of _Patrinia_ on BRL-3A cell apoptosis through the

TLR4/PI3K/AKT/GSK3β and TLR4/P38/JNK signaling pathways. _Mol. Med. Rep._ 17, 5344–5349. https://doi.org/10.3892/mmr.2018.8466 (2018). Article  CAS  PubMed  Google Scholar  * Guan, Z., Chen,

J. & Li, X. Patrinia herba aqueous extract on the proliferation, apoptosis, invasion and migration of hepatocellular carcinoma cells. _Cell Mol. Biol. (Noisy-le-grand)_ 66, 119–124.

https://doi.org/10.14715/cmb/2020.66.3.18 (2020). Article  PubMed  Google Scholar  * Bai, M. _et al._ Iridoid glycoside and lignans from a wild vegetable (_Patrinia villosa_ Juss.) with

antioxidant activity. _J. Food Biochem._ 42, 1–6. https://doi.org/10.1111/jfbc.12521 (2018). Article  CAS  Google Scholar  * Zhonghua Bencao Editorial Committee, State Administration of

Traditional Chinese Medicine. _Zhonghua Bencao (The Chinese Herbal)_, 10 Volumes (Shanghai Scientific and Technical Press, 1999). * Jiangsu New Medical College. _Zhongyao Da Cidian (An

Encyclopedia of Chinese Medicines)_, 2 Volumes (Shanghai People’s Press, 1977). * The Chinese Pharmacopoeia Commission. _Chinese Pharmacopoeia 2020 edition_, 4 Volumes (China Medical Science

and Technology Press, 2020). * Li, X. C. _et al._ _Patrinia villosa_ treat colorectal cancer by activating PI3K/Akt signaling pathway. _J. Ethnopharmacol._ 309, 1–11.

https://doi.org/10.1016/j.jep.2023.116264 (2023). Article  CAS  Google Scholar  * Chen, L. _et al._ _Patrinia scabiosaefolia_ inhibits colorectal cancer growth through suppression of tumor

angiogenesis. _Oncol. Rep._ 30, 1439–1443. https://doi.org/10.3892/or.2013.2582 (2013). Article  PubMed  Google Scholar  * Zhang, M. _et al._ _Patrinia scabiosaefolia_ inhibits the

proliferation of colorectal cancer in vitro and in vivo via G1/S cell cycle arrest. _Oncol. Rep._ 33, 856–860. https://doi.org/10.3892/or.2014.3663 (2015). Article  PubMed  Google Scholar  *

Zhang, X., Rui, M. J., Xu, H. T. & Chou, G. X. Lignans, monoterpenes and γ-pyrone derivatives from _Patrinia scabiosifolia_ with cytotoxic activity against HCT-116 cells. _Chem.

Biodivers._ 17, 1–9. https://doi.org/10.1002/cbdv.202000397 (2020). Article  CAS  Google Scholar  * Huang, S. Z. _et al._ _Patrinia scabiosaefolia_ inhibits growth of 5-FU-resistant

colorectal carcinoma cells via induction of apoptosis and suppression of AKT pathway. _Chin. J. Integr. Med._ 25, 116–121. https://doi.org/10.1007/s11655-018-3002-6 (2019). Article  CAS 

PubMed  Google Scholar  * Sheng, L., Yang, Y., Zhang, Y. & Li, N. Chemical constituents of _Patrinia heterophylla_ Bunge and selective cytotoxicity against six human tumor cells. _J.

Ethnopharmacol._ 236, 129–135. https://doi.org/10.1016/j.jep.2019.03.005 (2019). Article  CAS  PubMed  Google Scholar  * Mu, L. H., Wang, Y. N., Liu, L. & Liu, P. New iridoids from the

whole plant of _Patrinia heterophylla_. _Chem. Nat. Compd._ 55, 32–35. https://doi.org/10.1007/s10600-019-02609-7 (2019). Article  CAS  Google Scholar  * Zhang, L. _et al._ Anti-tumor and

immunomodulatory effect of flavonoid extracts from _Patrinia heterophylla_ on cervical carcinoma bearing mice. _Nat. Prod. Commun._ 12, 1069–1072. https://doi.org/10.1177/1934578x1701200717

(2017). Article  CAS  Google Scholar  * Xiang, Y. L. _et al._ Evolution and transition of source of Patrinia Herba and Patrinia Radix. _Zhongguo Zhong Yao Za Zhi_ 42, 2606–2611.

https://doi.org/10.19540/j.cnki.cjcmm.20170614.006 (2017). Article  PubMed  Google Scholar  * Singh, R. Chemotaxonomy: A tool for plant classification. _J. Med. Plants Stud._ 4, 90–93

(2016). Google Scholar  * Waksmundzka-Hajnos, M., Sherma, J., Kowalska, T. Overview of the field of TLC in phytochemistry and the structure of the book in _Thin-Layer Chromatography in

Phytochemistry_ 3–14 (CRC Press, 2008). * Schibli, A., & Reich, E. Modern TLC: A key technique for identification and quality control of botanicals and dietary supplements. _J. Planar

Chromatogr. Mod. TLC_ 18, 34–38. https://doi.org/10.1556/jpc.18.2005.1.6 (2005). * Zarrei, M. _et al._ DNA barcodes from four loci provide poor resolution of taxonomic groups in the genus

_Crataegus_. _AoB Plants_ 7, 1–19. https://doi.org/10.1093/aobpla/plv045 (2015). Article  CAS  Google Scholar  * Starr, J. R., Naczi, R. F. & Chouinard, B. N. Plant DNA barcodes and

species resolution in sedges (_Carex_, Cyperaceae). _Mol. Ecol. Resour._ 9, 151–163. https://doi.org/10.1111/j.1755-0998.2009.02640.x (2009). Article  CAS  PubMed  Google Scholar  * Kim, W.

J. _et al._ Development of molecular marker for the authentication of Patriniae Radix by the analysis of DNA barcodes. _Korea J. Herbol._ 29, 45–53. https://doi.org/10.6116/kjh.2014.29.6.45

(2014). Article  Google Scholar  * Moon, B. C. _et al._ Development of molecular markers for authentication of the medicinal plant species _Patrinia_ by random amplified polymorphic DNA

(RAPD) analysis and multiplex-PCR. _Hortic. Environ. Biotechnol._ 57, 182–190. https://doi.org/10.1007/s13580-016-0064-2 (2016). Article  Google Scholar  * Yik, M. H. Y. _et al._

Differentiation of _Hedyotis diffusa_ and common adulterants based on chloroplast genome sequencing and DNA barcoding markers. _Plants_ 10, 1–12. https://doi.org/10.3390/plants10010161

(2021). Article  CAS  Google Scholar  * Ngai, H. L., Kong, B. L. H., Lau, D. T. W. & Shaw, P. C. Differentiation of Lingxiaohua and Yangjinhua by chloroplast genome sequencing and DNA

barcoding markers. _Genome_ 66, 21–33. https://doi.org/10.1139/gen-2022-0063 (2022). Article  CAS  PubMed  Google Scholar  * Chen, H. B. & Cheng, J. R. Studies on the medicinal plants of

Valerianaceae in China. _China Zhongguo Zhong Yao Za Zhi_ 19, 67–126 (1994). CAS  PubMed  Google Scholar  * Chen, M. X. _et al._ Pharmacognosic identification of six medicinal plants of

_Patrinia_. _J. Anhui Univ. Chin. Med._ 39, 78–81 (2020). CAS  Google Scholar  * Tian, R. T. _et al._ Evaluation of traditional Chinese herbal medicine: Chaihu (Bupleuri Radix) by both

high-performance liquid chromatographic and high-performance thin-layer chromatographic fingerprint and chemometric analysis. _J. Chromatogr. A_ 11, 2150–2155.

https://doi.org/10.1016/j.chroma.2008.10.127 (2009). Article  CAS  Google Scholar  * Katoh, K., Rozewicki, J. & Yamada, K. D. MAFFT online service: multiple sequence alignment,

interactive sequence choice and visualization. _Brief. Bioinform._ 20, 1160–1166. https://doi.org/10.1093/bib/bbx108 (2019). Article  CAS  PubMed  Google Scholar  * Rozas, J. _et al._ DnaSP

6: DNA sequence polymorphism analysis of large data sets. _Mol. Biol. Evol._ 34, 3299–3302. https://doi.org/10.1093/molbev/msx248 (2017). Article  CAS  PubMed  Google Scholar  * Richterich,

P. CodonCode aligner version 12 released. _Genet. Med._ 6, 162–163. https://doi.org/10.1097/00125817-200405000-00012 (2004). Article  Google Scholar  * Kumar, S., Stecher, G., Li, M., Knyaz,

C. & Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. _Mol. Biol. Evol._ 35, 1547–1549. https://doi.org/10.1093/molbev/msy096 (2018). Article  CAS

  PubMed  PubMed Central  Google Scholar  * Wang, H. X. _et al._ Plastid phylogenomic insights into the evolution of the Caprifoliaceae sl (Dipsacales). _Mol. Phylogenet. Evol._ 142, 1–13.

https://doi.org/10.1016/j.ympev.2019.106641 (2020). Article  Google Scholar  * Hall, T. A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows

95/98/NT. _Nucl. Acids Symp. Ser._ 41, 95–98 (1999). CAS  Google Scholar  Download references AUTHOR INFORMATION Author notes * These authors contributed equally: Kwan-Ho Wong and Tao Zheng.

AUTHORS AND AFFILIATIONS * Shiu-Ying Hu Herbarium, School of Life Sciences, The Chinese University of Hong Kong, Shatin, New Territories, Hong Kong SAR, China Kwan-Ho Wong, Man-Ching Li 

& David Tai-Wai Lau * School of Life Sciences, The Chinese University of Hong Kong, Shatin, New Territories, Hong Kong SAR, China Kwan-Ho Wong, Pang-Chui Shaw & David Tai-Wai Lau *

Li Dak Sum Yip Yio Chin R&D Centre for Chinese Medicine, The Chinese University of Hong Kong, Shatin, New Territories, Hong Kong SAR, China Kwan-Ho Wong, Hoi-Yan Wu, Clara Bik-San Lau, 

Pang-Chui Shaw & David Tai-Wai Lau * Institute of Chinese Medicine, The Chinese University of Hong Kong, Shatin, New Territories, Hong Kong SAR, China Tao Zheng, Grace Gar-Lee Yue, 

Man-Ho Tong, Clara Bik-San Lau & Pang-Chui Shaw * State Key Laboratory of Research On Bioactivities and Clinical Applications of Medicinal Plants, The Chinese University of Hong Kong,

Shatin, New Territories, Hong Kong SAR, China Tao Zheng, Grace Gar-Lee Yue, Man-Ho Tong, Clara Bik-San Lau & Pang-Chui Shaw * The Institute of Medicinal Plant Development, The Chinese

Academy of Medical Sciences and Peking Union Medical College, Haidian, Beijing, China Xin-Lei Zhao * School of Chinese Medicine, Hong Kong Baptist University, Kowloon Tong, Hong Kong SAR,

China Hu-Biao Chen * Department of Pharmacology and Pharmacy & School of Chinese Medicine, Li Ka Shing Faculty of Medicine, The University of Hong Kong, Pokfulam, Hong Kong SAR, China

Clara Bik-San Lau Authors * Kwan-Ho Wong View author publications You can also search for this author inPubMed Google Scholar * Tao Zheng View author publications You can also search for

this author inPubMed Google Scholar * Grace Gar-Lee Yue View author publications You can also search for this author inPubMed Google Scholar * Man-Ching Li View author publications You can

also search for this author inPubMed Google Scholar * Hoi-Yan Wu View author publications You can also search for this author inPubMed Google Scholar * Man-Ho Tong View author publications

You can also search for this author inPubMed Google Scholar * Xin-Lei Zhao View author publications You can also search for this author inPubMed Google Scholar * Hu-Biao Chen View author

publications You can also search for this author inPubMed Google Scholar * Clara Bik-San Lau View author publications You can also search for this author inPubMed Google Scholar * Pang-Chui

Shaw View author publications You can also search for this author inPubMed Google Scholar * David Tai-Wai Lau View author publications You can also search for this author inPubMed Google

Scholar CONTRIBUTIONS C.B.-S.L., D.T.-W.L. and P.-C.S. conceived the work and obtained funding. K.-H.W., T.Z., H.-Y.W. and M.-H.T. conducted the experiments. K.-H.W., T.Z. and H.-Y.W.

analyzed the data. C.B.-S.L., D.T.-W.L. and P.-C.S. supervised the work. K.-H.W., T.Z., G.G.-L.Y., M.-C.L., X.-L.Z., H.-B.C. and D.T.-W.L. involved in specimen processing and taxonomical

identification of the research materials. K.-H.W., T.Z. and D.T.-W.L. wrote the manuscript and all authors contributed to the manuscript improvement. CORRESPONDING AUTHORS Correspondence to

Clara Bik-San Lau, Pang-Chui Shaw or David Tai-Wai Lau. ETHICS DECLARATIONS COMPETING INTERESTS The authors declare no competing interests. ADDITIONAL INFORMATION PUBLISHER'S NOTE

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION. RIGHTS AND

PERMISSIONS OPEN ACCESS This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any

medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The

images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is

not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission

directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Reprints and permissions ABOUT THIS ARTICLE CITE THIS ARTICLE Wong,

KH., Zheng, T., Yue, G.GL. _et al._ A systematic approach for authentication of medicinal _Patrinia_ species using an integration of morphological, chemical and molecular methods. _Sci Rep_

14, 6566 (2024). https://doi.org/10.1038/s41598-024-57115-w Download citation * Received: 30 October 2023 * Accepted: 14 March 2024 * Published: 19 March 2024 * DOI:

https://doi.org/10.1038/s41598-024-57115-w SHARE THIS ARTICLE Anyone you share the following link with will be able to read this content: Get shareable link Sorry, a shareable link is not

currently available for this article. Copy to clipboard Provided by the Springer Nature SharedIt content-sharing initiative