Endothelial autophagy: an effective target for radiation-induced cerebral capillary damage

ABSTRACT Toxicity to central nervous system tissues is the common side effects for radiotherapy of brain tumor. The radiation toxicity has been thought to be related to the damage of

cerebral endothelium. However, because of lacking a suitable high-resolution _vivo_ model, cellular response of cerebral capillaries to radiation remained unclear. Here, we present the

_flk:eGFP_ transgenic zebrafish larvae as a feasible model to study the radiation toxicity to cerebral capillary. We showed that, in living zebrafish larvae, radiation could induce acute

cerebral capillary shrinkage and blood-flow obstruction, resulting brain hypoxia and glycolysis retardant. Although _in vivo_ neuron damage was also observed after the radiation exposure,

further investigation found that they didn’t response to the same dosage of radiation _in vitro_, indicating that radiation induced neuron damage was a secondary-effect of cerebral vascular

function damage. In addition, transgenic labeling and qPCR results showed that the radiation-induced acute cerebral endothelial damage was correlated with intensive endothelial autophagy.

Different autophagy inhibitors could significantly alleviate the radiation-induced cerebral capillary damage and prolong the survival of zebrafish larvae. Therefore, we showed that radiation

could directly damage cerebral capillary, resulting to blood flow deficiency and neuron death, which suggested endothelial autophagy as a potential target for radiation-induced brain

toxicity. SIMILAR CONTENT BEING VIEWED BY OTHERS INTRAVENOUS INJECTION OF CYCLOPHILIN A REALIZES THE TRANSIENT AND REVERSIBLE OPENING OF BARRIER OF NEURAL VASCULATURE THROUGH BASIGIN IN

ENDOTHELIAL CELLS Article Open access 29 September 2021 ACETYLATION OF Α-TUBULIN RESTORES ENDOTHELIAL CELL INJURY AND BLOOD–BRAIN BARRIER DISRUPTION AFTER INTRACEREBRAL HEMORRHAGE IN MICE

Article Open access 07 May 2025 BRAIN-DERIVED ENDOTHELIAL CELLS ARE NEUROPROTECTIVE IN A CHRONIC CEREBRAL HYPOPERFUSION MOUSE MODEL Article Open access 18 March 2024 INTRODUCTION Most of

patients with primary brain tumors or metastases tumors had to undergo radiotherapy, such as whole-brain radiotherapy (WBRT), stereotactic radio surgery (SRS) and intensity modulated

radiation therapy (IMRT)1,2. Although radiotherapy was an effective treatment for brain tumors3,4,5, experimental and clinical evidence suggested that more than 40% of people receiving

radiotherapy would suffer from brain damage and mainly manifested as cognitive dysfunction6. Radiation-induced cognitive dysfunction refers to the dysfunction of memory, learning, processing

speed, and attention, occurring in 50–90% of these patients and gradually becoming irreversible2,7,8. Although radiotherapy-induced brain damage has been discussed in many studies, the

cellular and molecular mechanisms of radiation-induced brain damage is still controversial. Radiation can damage neuronal, glial and vascular compartments of the brain and may lead to

molecular, cellular and functional changes9. The neurovascular unit (NVU), composed of neurons, interneurons, astrocytes, endothelial cells, basal lamina, and extracellular matrix, is the

basal structure of brain homeostasis10. these cells work together intimately and be closely coordinated, which ensure dynamic linkages in reciprocal way under physiological conditions11.

Although the radiotherapy would induce the damage of all components, the endothelial cells were more sensitive to radiation12,13 and showed significant increased caspase-3/7 activity in a

radiation dose-dependent manner, whereas microglia and neuronal cells exhibited lower ratio of dead cells at each dose studied14. As the brain is a constant metabolic demand organ15

(consuming 20% of the body), endothelium damage and decreased microcirculation might lead to poor perfusion of brain tissue, which could cause death of other cells (including neurons and

glial cells) within the neurovascular unit. Varies animal models have been applied to study the radiation induced vascular damage, they found that radiation therapy could induce

dose-dependent endothelial apoptosis16, disruption of the blood-brain barrier17, vascular rarefaction, and cognitive deficits18. However, few can reveal the _in vivo_ morphological and

functional changes of cerebral capillaries after exposing to ionizing radiation. The zebrafish has been served as an important animal model to study the geneses of the vascular and nervous

system disease19,20. The small size, optical translucency, and conservative gene of the zebrafish larvae, in combination with a variety of fluorescent labeling transgenic lines permit

real-time and high-resolution observation of morphological and gene-expression changes in endothelial cells _in vivo_. Therefore, we established a zebrafish model using the larvae of

transgenic zebrafish (_flk:eGFP_) to study radiation-induced cerebrovascular damage. Continuously confocal tracking astonishingly discovered the morphologically and functionally changes in

cerebral capillaries after radiation. 3D coculture of zebrafish neurons and endothelial cells suggested that endothelial cells were more sensitive to radiation compared with other cells in

brain. Whole-brain living images of _fli1a:mCherry-GFP-LC3_ transgenic zebrafish larvae and q-PCR data indicated the association of endothelial autophagy with the radiation induced damage to

cerebral capillary. Finally, autophagy inhibition experiments highlighted the use of autophagy inhibitors in relieving the damage of cerebral capillaries and the subsequent effect to the

neurons and glia after the radiotherapy. MATERIALS AND METHODS CLINICAL RESEARCH From the database of West China Hospital, a patient who was diagnosed with glioma and underwent Computed

Tomography angiography (CTA) before and after brain radiation was enrolled. The interval time of the patient from first to last radiation was within 40 days, the times of radiation was 10,

and total dosage of radiotherapy was 40 Gy. The clinical research has received approval from the institutional review board of the Medical Faculty at the West China Hospital, Sichuan

University and all methods were carried out in accordance with relevant guidelines and regulations. The written informed consent was obtained from this patient. TRANSGENIC ZEBRAFISH

MAINTENANCE AND ESTABLISHMENT Lines used in this study included _flk:eGFP_ (zfin: s843Tg), _HuC:mCherry_ (zfin: nia02Tg). _GFAP:mCherry_ and _fli1a:mCherry-GFP-LC3_ were established using

multisite gateway system (Life Technologies) and Tol2 kit21. Zebrafish were maintained at 28.5 °C with a 14-hour light/10- hour dark cycle as previously described22. Embryos were kept in

incubator at 28.5 °C, and treated with 0.1 Mm 1-phenyl-2-thiourea (PTU, Sigma P5272) to inhibit pigment formation beyond 24 hours post-fertilization. All zebrafish experiments were conducted

in accordance with the guidelines of the Animal Care and Use Committee of Sichuan University (Chengdu, Sichuan, China) and approved by the institutional review board of the Medical Faculty

at the West China Hospital, Sichuan University. 3-D CULTURE OF TRANSGENIC ZEBRAFISH NEURONS AND ENDOTHELIAL CELLS _flk:eGFP_ and _HuC:mCherry_ transgenic zebrafish were incrossed and the

embryos were collected. At 80% epiboly/tailbud stage, embryos were washed with PBS containing 5X antibiotics. All embryos were then dechorionated at six hours post fertilization using

pronase enzyme degradation. Twenty embryos in each group were then dissociated into single cells with continuous pipetting. Zebrafish embryos cells were then seeded into matrigel in 48-well

plates for 1 week. The cells were cultured by complete DMEM/F12 medium (Gibco) supplemented with epidermal growth factor (EGF, 20 ng/ml, Peprotech), basic fibroblast growth factor (bFGF, 10 

ng/ml, Peprotech) and B27 (1 × , Invitrogen). Before or after the ionizing radiation, the cells were generally maintained at 28 °C with 5% CO2. X-RAY RADIATION Radiation experiments were

performed according to the Radiation Safety Manual of West China Hospital, Sichuan University. Briefly, zebrafish larvae (8dpf, days post fertilization) were stably mounted in the central of

2.5 cm thick 3% Sodium carboxymethlycellulose (SCMC). Larvae mounted in 6-well dish were then directly exposed to X-Ray Radiation (ELEKTA, Versa HD, Sweden) with 10 cm × 10 cm of filed size

at West China Hospital. Larvae in the radiated group received a single 5 Gy and 10 Gy dose radiation respectively. Control larvae were treated identically but received no radiation. The

larvae were put back into incubator within 30 min after radiation exposure. IMAGING STRATEGY AND QUANTIFICATION For imaging cerebral vasculature of zebrafish _in vivo_, selected embryos were

mounted in low melting point (LMP) agarose (1%, wt/vol) at the bottom of a 29 mm glass bottom dish and covered with fish water at 33 °C. The real-time tracking images were taken with Zeiss

LSM 880 Confocal Microscope with Airyscan (Carl Zeiss, Germany). The midbrain region of each brain were imaged with a confocal microscope under 40× lens with a total depth of 100 μm. We

counted LC3 puncta on all blood vessels, and calculated the number of puncta on each 100μm vessels. We calculated the number of all perfused vessel branches and vascular diameter basing on

fluorescent images by ZEN blue and analyzed by the Prism software. BRAIN ANGIOGRAPHY AND CEREBRAL BLOOD VOLUME MONITOR For intracranial angiography of zebrafish larva _in vivo_, fluorescein

sodium (Sigma F6337, 376 Da) and Dextran blue (MW, 10 kDa) were dissolved in PBS to final concentrations of 2 mg/ml and 12.5 mg/ml respectively. Zebrafish larvae were anesthetized with 0.2 

mg/ml Tricaine (Sigma A5040) before the tracker injection. For brain angiography, about 3 nl of tracers were injected into each larva from pericardium and confocal live images were taken

within 1–2 hours post the tracer injection. The whole brain perfusion images were taken with Confocal Microscope. The brain of zebrafish was moved to the center of the field of vision, and

all images generally had a same depth (100 μm). We calculated number of all perfused vessel branches in fluorescent images and quantified by the Prism software. For the cerebral blood-volume

monitor assay, 1 hour after the tracer injection, the brains of the zebrafish larvae (n = 6 in each group) were dissected out using tweezers under a stereomicroscope. The brains were then

completely digested using 100 μl of mixture of 0.25% trypsin, 2.5 mg/ml collagenase IV and 1 mg/ml DNAses. After high-speed centrifuge (2000 rpm/min) for 10 min, the fluorescent intensity of

fluorescein sodium and Dextran blue in the supernatants were measured using a fluorescence microplate reader (FLx800™). HYPOXIA DETECTION ASSAY AND NAD(P)H AUTOFLUORESCENCE ASSESSMENT

Intracranial hypoxia was evaluated using a hypoxia-detecting probe (MAR, Goryo Chemical, Japan) as the manufacturer described23. Briefly, hypoxia-detecting probe was injected directed into

the zebrafish brain at 4-day post radiation (dpr) and the injected zebrafish were then maintained in incubator for 2 hours. Then the zebrafish larvae were fixed with 4% PFA and the brains

were isolated with tweezers under a stereomicroscope. After staining, the fluorescence intensity of the zebrafish brain was analyzed by Confocal (Leica SP5). For NAD(P)H assessment, the

brain samples were fixed with 4% PFA for 4 hours, and then washed with PBS for 1 hour. NAD(P)H had its own autofluorescence, and it absorbs light of wavelength 340 ± 30 nm and emits

fluorescence at 460 ± 50 nm24. The specific fluorescent intensity of NAD(P)H in each sample was imaged using a confocal (Leica SP5), and quantified by image J. QUANTITATIVE REAL-TIME PCR The

cerebral endothelial cells of flk:eGFP transgenic zebrafish larvae are showing green fluorescence and the cells were isolated by FACS. Total RNA was extracted using an RNeasy column

(Axygen), and cDNA was obtained using SuperScript III reverse transcriptase (Invitrogen). Quantitative PCR (qPCR) was then performed on an ABI7300 thermocycler (Applied Biosystems) using

SYBR green Master Mix (Applied Biosystems). The relative fold change of autophagy related genes, including _lc3, beclin1, atg5_ and _ambra_, were calculated in 0, 5 and 10 Gy group at 2-day

and 4-day post radiation. The following primers were used: _β-actin_ (CTTCTTGGGTATGGAATCTTGC and GTACCACCAGACAATACAGTG); _lc3_ (GAGAAGTTTTTGCCGCCTCT and ACCTGTGTCCGAACATCTCC); _atg5_

(AGGATACCCGCCTGTTTCAC and TCCCTCGTGTTCAAACCACA); _beclin1_ (CATCACTGAGAACGAGTGCCA and CTGTGGTTGCGTCCCTCATC); _ambra_ (CTGCTGCTCATTGCCACC and CTGCTCCTCATGCTGACC). FLOW CYTOMETRY To test

survival of neurons and glial cells after radiation, the zebrafish brains were dissected and digested on 4day post radiation as previous described. DAPI/AnnexinV-FITC staining was performed

according to the standard method25. Flow Cytometry data were acquired by FACSVerse (BD Biosciences) and analyzed by FlowJo software (Tree Star). The apoptosis test of neurons and endothelial

cells in 3-D culture system was performed using the same DAPI/AnnexinV-FITC staining in a similar way. DRUG ADMINISTRATION DETAILS A clinical anti-vasoconstriction drug nimodipine and three

autophagy inhibitors (Wortamanin, Ly294002 and Chloroquine) (Selleck). These small molecular inhibitors were added directly into fish water. Nimodipine (5 μM) was immediately added into

fish water after the radiation exposure, and the drug was changed daily for continuing 4 days. Living brain imaging by confocal was done at 2 and 4dpr. For the autophagy inhibitor treat

groups, zebrafish embryos were soaked in fish water containing autophagy inhibitors (Wortamanin (1 μM), Ly294002 (10 μM) and Chloroquine (100 μM)) for 6 hours each day, and then washed and

changed with fresh water until the death of these radiated larvae. STATISTICAL ANALYSIS Prism software was used for statistical analysis. All datasets were challenged by a normality test.

Datasets with a Normal distribution were analyzed by unpaired t test. For zebrafish survival studies, Kaplan–Meier survival curves were generated and analyzed for statistical significance

with GraphPad Prism. A level of *P < 0.05 or **P < 0.01 was regarded as statistically significant. RESULTS WHOLE-BRAIN-RADIATION THERAPY IMPAIRS THE INTRACRANIAL BLOOD-PERFUSION IN A

GLIOMA PATIENT A patient from West China Hospital was collected in the present study. This patient was diagnosed with glioma and underwent Computed Tomography angiography (CTA) before and

after brain radiation. The patient totally received 10 times of whole brain radiation (the total radiotherapy dosage is 40 Gy) within 40 days from June 2016 to July 2016. After comparing

3-dimensional computed tomography angiography (Fig. 1), we found that the intracranial vessels and blood-perfusion was significantly affected after the last time of radiation. Some big

intracranial vessels (such as left post cerebral artery) (Fig. 1) shrank after 10 times of brain radiation and partial small cerebral vessels (such as branches of right middle cerebral

artery and branches of post cerebral artery) (Fig. 1) could no longer be detected by CTA after the radiation. This piece of clinical data from this glioma patient implies that intensive

brain radiation might result damage of intracranial vessels and reduction of the cerebral blood-perfusion. X-RAY RADIATION RESULTS ACUTE SHRINKAGE OF CEREBRAL CAPILLARIES OF ZEBRAFISH LARVA

Zebrafish has been envisioned as a popular vertebrate model system for studying radioprotection26. Here, to establish a zebrafish X-ray Radiation damage model, 8dpf zebrafish embryos were

stably mounted in the central of 2.5 cm thick 3% Sodium carboxymethlycellulose (SCMC). Mounted Larvae were exposed to a single dose of X-Ray Radiation (5 Gy and 10 Gy), and then were

released to fresh water for viability and behavior assessment (Fig. 2A). At 2dpr, we found, although the zebrafish morphology looks normal, most of the radiated-larvae had obvious balance

and coordination problems (Fig. 2B). Larvae couldn’t keep themselves steady in the water and kept readjusting their bodies (Fig. 2B, upper panel). In addition, by track the swim

trajectories, we found that the radiated-larvae were reluctant to swim, comparing with the control larvae at the same age (Fig. 2B, lower panel). Then, to investigate the acute changes of

cerebral vasculature of the zebrafish larvae exposing to radiation, we employed the _flk:eGFP_ transgenic zebrafish. The endothelial cells of the _flk:eGFP_ zebrafish were GFP labeled and

the zebrafish larvae were transparent, which enable us to image and reconstruct the whole cerebral vasculature of zebrafish larva at single-cell resolution by confocal. Interestingly, living

images of the brain vasculature revealed that the general diameter of cerebral capillaries of the radiated-larvae were smaller than that in the untreated zebrafish (Fig. 2C). Quantitative

analysis indicated that the shrinkage of cerebral capillaries was radiation dosage dependent (Fig. 2C,D). In addition, time-series evaluation results indicated that the radiation-induced

capillary shrinkage was irreversible over time (Fig. 2D) and most of the radiated-larvae (5 Gy and 10 Gy) would die, within 6 days post the radiation (Fig. 2E). We also imaged and evaluated

the cardiovascular system and the cardiac function of the larvae after exposing to radiation. Fluorescent images indicated that the size and movement of Bulbus Arteriosus (BuA) during a

cardiac cycle was similar to the untreated larvae (Fig. 2F) and the heart beat rate was also not affected (p = 0.57, Fig. 2F). These results suggested the relatively normal cardiovascular

function of zebrafish larvae after exposing to radiation. Altogether, our results showed that single dose of X-ray radiation could specifically induce an irreversible cerebral capillary

damage in zebrafish larvae. RADIATION-INDUCED CEREBRAL CAPILLARY SHRINKAGE AFFECTS CEREBRAL BLOOD-PERFUSION IN ZEBRAFISH LARVAE To monitor the cerebral blood flow in zebrafish larva after

exposing to radiation, Dextran blue (10,000 MW) and fluorescein sodium (376 MW) were pericardially injected into _flk:eGFP_ zebrafish larva at different time points before the imaging and

evaluation. The whole brain confocal images revealed that the blue-dextran-labeled blood-flow in the cerebral capillaries continuing declining after exposing to the radiation (Fig. 3A,B). In

addition, to quantify the changes of blood volume in the zebrafish brain, at different time points (0, 2, 4 dpr), we dissected the larva brains (n = 10 in each group at every time point)

under a stereomicroscope. The brains in each group were completely digested and the fluorescence intensity (dextran blue and fluorescein sodium) of the supernatant was normalized and

measured (Fluorescence Microplate Reader, Thermo). Consistent with the angiography of cerebral vessels, we found that the fluorescent intensity of the radiated-brains supernatant was much

lower than that in the untreated group (Fig. 3C,D), suggested a reduction of the blood volume in the radiated brains. Brain blood-volume reduction could be resulted from the cerebral

capillary shrinkage that induced by radiation. To clarify this relationship, we tried to rescue the brain blood flow defect by using a clinical anti-vasoconstriction drug-Nimodipine.

Nimodipine is a calcium channel blocker and has some selectivity for cerebral vasculature. Nimodipine (5 μM) was directly added into fish water after the radiation exposure, and the drug was

changed daily for continuing 4days. Living brain imaging by confocal was done at 2 and 4dpr. As expected, with the Nimodipine treatment, obvious vasodilation of the cerebral capillaries of

the radiated-larvae was observed at 2dpr and the cerebral blood-perfusion showed a marked improvement (Fig. 3E,F). However, this improvement only lasts for a short time. At 4dpr, even with

the continuing Nimodipine treatment, the cerebral blood-perfusion in the radiated-larva was dramatically dropped and severely vascular shrinkage was detected (Fig. 3E,F). As a result, the

short-term effect of Nimodipine on the cerebral vasoconstriction only resulted in a limited over-all survival improvement after the radiation (Fig. 3G). RADIATION-INDUCED CEREBRAL

BLOOD-PERFUSION DEFICIENCY RESULTS SECONDARY NEURON AND GLIAL CELLS DAMAGE IN ZEBRAFISH BRAIN To investigate the influence of radiation-induced cerebral vascular damage, we carried out a

series of _in vivo_ and _in vitro_ experiments. Firstly, by measuring intensity of the NAD(P)H-related autofluorescence in the zebrafish brain27, we monitored the changes of cerebral energy

metabolism of zebrafish larvae after exposing to radiation. The NADPH auto fluorescent signaling is mainly located in the telencephalon, diencephalon and mesencephalon of zebrafish brain

(Fig. 4), which is generally overlapped with the regions with high neuron metabolism. In accordance with the shrinkage of the cerebral capillaries, Confocal images showed that the

NAD(P)H-related fluorescence in the radiated-brains was dramatically reduced at 4dpr (Figs. 4A, S1). Next, by using the hypoxia detection probe together with the neuron-labeled transgenic

zebrafish (_HuC:mCherry_), we revealed the severe hypoxia (green channel) in the zebrafish brains at 4dpr (Fig. 4B). At the same time, we found that rare healthy neurons (mCherry+) were

detected in the radiated-brains at 4dpr, compared with the untreated zebrafish brains (Fig. 4B). Vertebrate neurons are generally viewed as among the most anoxia-sensitive of all cells28,29.

The death of neurons from hypoxia and glucose deprivation in the radiated brains can follow quickly from necrosis or in other slower ways, such as apoptosis. To determine the possible role

of programmed cell death in the radiated zebrafish brains, we then applied annexin V apoptosis assay. To monitor the neuron and glial cells in the zebrafish brain, we used either

neurons-labeled _HuC:mCherry_ or the glia-labeled _GFAP:mCherry_ transgenic zebrafish in the radiation test. At 2dpr, we digested the brains of the transgenic zebrafish larvae (n = 10 in

each group) that with or without radiation exposure (10 Gy) and staining of DAPI/FITC-annexin V was then applied. Flow cytometry results indicated that higher apoptosis ratio of neurons and

glial cells in the brains with radiation exposure. To confirm that the neuron damage was mainly a secondary effect of radiation-induced cerebral blood flow deficiency, rather than a direct

toxicity of radiation. We co-cultured the zebrafish neurons and endothelial cells in 3D Matrigel and exposed these cells to X-ray radiation at the same dose as we tested in zebrafish (5 and

10 Gy). The co-cultured neurons and endothelial cells were maintained at 28 °C with 5% CO2, supplied with sufficient glucose and essential growth factors (methods and materials). At 4dpr, we

evaluated the status of endothelial cells (_flk:eGFP_) and neurons (_Huc:mCherry_). As showed in the fluorescent channel (Fig. 4D), control endothelial cells in the 3D Matrigel behaved as

normal, forming endothelial sprouts and connecting with each other. However, the radiated endothelial sprouts were much thinner and were more retracted than the control (Fig. 4D).

Endothelial sprouts in the Matrigel were then digested into single cells and counted. The result indicated that, except for the morphological changes, there were actually less endothelial

cells survived in the wells after the radiation and the cell number reduction was radiation-dose dependent (Fig. 4E). On the other hand, we also evaluated the cell status of the neurons in

the 3D Marigel after the radiation as we did with endothelial sprouts. Interestingly, contrasts to the endothelial cells, neurons were more resistant to radiation. No detectable

morphological or cell number changes were observed (Fig. 4F,G). In addition, annexin V apoptosis assay indicated that no significant apoptosis was initiated in the culturing neurons after

exposing to radiation (Fig. 4H). These results together indicated that endothelial cells, compared with neurons, are more sensitive to radiation. And it’s highly possible that the _in vivo_

neuron death after the radiation was attributed to the radiation-induced cerebral damage and intracranial ischemia. RADIATION INDUCES INTENSIVE AUTOPHAGY FLUX IN THE CEREBRAL ENDOTHELIAL

CELLS IN ZEBRAFISH LARVAE The radiation-induced endothelial damage results in severe cerebral capillary shrinkage, which leads to intracranial ischemia and the death of neurons and glial

cells. However, the mechanism of radiation induced endothelial damage remains unclear. Previous studies showed that radiation almost uniformly promotes autophagy in tumor cells30 and

extensive autophagy has been related to programmed cell death31. Thus, to track the possible endothelial autophagy flux after radiation exposure, we established a transgenic zebrafish line

(fli:mCherry-GFP-LC3), in which the endothelial cells specifically expressing chimeric LC3 fused to both GFP (acid sensitive) and mCherry (acid stable). This chimeric LC3 protein has been

used to monitor autophagosome transport32,33. The fli:mCherry-GFP-LC3 transgenic zebrafish larvae (8dpf) were exposed to X-ray radiation at different dosages as we did before. Confocal

images at 4dpr showed that, contrasts to the untreated larvae, abundant LC3 puncta were detected in the cerebral endothelium of radiated zebrafish larvae (Fig. 5A). Quantitative analysis

indicated that the number of the LC3 puncta were radiation dosage dependent (Fig. 5B). In addition, in the 5 Gy group, partial of the puncta were GFP and mCherry double positive, indicating

that these autophagosomes had not yet fused with the lysosomes. And in the 10 Gy group, most of the LC3 puncta were mCherry single positive, indicating the maturation of these autophagosomes

(Fig. 5A,B). To confirm the activation of endothelial autophagy after the X-ray radiation, we then isolated cerebral endothelial cells by FACS from zebrafish brains with or without

radiation exposure. The mRNA expression levels of autophagy related genes (_lc3, beclin1, atg5_ and _ambra1_) were then evaluated by qPCR. At both 2 and 4 dpr, the qPCR results showed that

the expression of evaluated autophagy-related genes were elevated in the cerebral endothelial cells of radiated brains, compared with that in the control larvae. Previous studies have

correlated the intensive autophagic flux with various forms of cell death34. Here, in our experiment, we found that the cerebral endothelial cells in the radiated zebrafish brains also

showed a higher expression of apoptotic genes (Fig. S2). Then, using AnnexinV/DAPI apoptosis assay, we indeed found a higher apoptotic ratio and lower percentage of living endothelial cells

in the radiated zebrafish brains were than that in the control brains (Fig. 5D,E). Hence, these results together suggested a role of radiation-induced endothelial autophagic damage or

autophagic death in the radiation-induced cerebral vascular damage and intracranial ischemia. INHIBITION OF AUTOPHAGY ALLEVIATES RADIATION-INDUCED CEREBRAL VASCULAR DAMAGE AND EXTENDS THE

SURVIVAL OF ZEBRAFISH LARVAE Autophagy is a double-edged sword, either keeping the cells survived through adverse microenvironment or directly incorporating in various forms of cell death.

Here, we revealed the general cerebral endothelium damage after exposing to radiation at different dosages (5 and 10 Gy), we rationalized that radiation-induced endothelial autophagy was

positively correlated to the cerebral capillary damage. To test this hypothesis, we tried several autophagy inhibitors: Wortamanin, Ly294002 and Cloroquine. PI3K is required for autophagy35

and inhibition of PI3K with LY294002 or Wortamanin can inhibit autophagic sequestration. Chloroquine inhibits autophagy as it raises the lysosomal pH, which leads to inhibition of both

fusion of autophagosome with lysosome and lysosomal protein degradation36. After exposing to radiation, zebrafish larvae were soaked in culturing water supplied with Wortamanin (1 μM),

Ly294002 (10 μM) or Cloroquine (100 μM) for 6 hours per day until the death of these radiated larvae. The dosages of anti-vasoconstriction drug Nimodipine and autophagy inhibitors

Wortamanin, Ly294002 and Cloroquine were determined by zebrafish maximum tolerated concentration and maximum patient’s plasma concentration of each compound. At 4dpr, Confocal images of

_fli:mCherry-GFP-LC3_ transgenic zebrafish larvae showed that that number of fluorescent LC3 puncta in the cerebral endothelium were significantly reduced with the treatment of autophagy

inhibitors (Fig. 6A,C) after radiation exposure. In addition, by using the _flk:eGFP_ transgenic larvae and the Dextran-blue angiography, we evaluated the changes of cerebral capillaries and

blood flow. As expected, with the treatment of autophagy inhibitors, the blood-perfusion in the brains of radiated larvae was significantly improved (Fig. 6B,D) and the survival of radiated

zebrafish larvae were also significantly extended, especially for the group that treated with ly294002 (Fig. 6E, p < 0.01). To study the change of zebrafish behavior caused by radiation

after using autophagy inhibitors, we evaluate their stability and moving tracks. We found the control radiated-larvae had obvious balance and coordination problems, and the radiated

zebrafish larvae using autophagy inhibitors showed more active and could keep balance (Fig. S3). These results indicate that radiation-induced intensive endothelial autophagy is positively

correlated to the cerebral vascular damage and could be served as a target for anti-radiation-induced brain toxicity. DISCUSSION Previous studies have suggested that endothelial cells were

more sensitive to radiation compared with neurons and glial cells; therefore, brain injury induced by radiotherapy may be related to vascular damage12. To test brain vascular pathogenicity

_in vivo_, we developed a transgenic zebrafish radiation model to study the radiation-induced cerebrovascular damage, which allowed real-time living tracking of endothelial damage and blood

perfusion in brain followed by ionizing radiation. In particular, the _(fli:mCherry-GFP-LC3)_ transgenic zebrafish and the qPCR analysis indicated that cerebral endothelial autophagy was

significantly associated with the radiation-induced cerebral capillary damage. Further autophagy inhibition experiments demonstrated a vital role of autophagy in radiation-induced

endothelial damage, highlighting the therapeutic potential of regulating autophagy for the treatment of radiation-induced brain injury. Using _flk:eGFP_ fish, we demonstrated the death of

cerebral vascular endothelial cells induced by radiation appeared in a dose-dependent pattern. Recent studies suggested radiation induced cerebral vascular damage begins with progressive

endothelial cells loss. In a rat radiation model, single dose of 5–20 Gy radiation in brain lead to a 15% decrease of endothelial cell number within 1 day, then followed by continuous

endothelial cells loss within a month37. In addition, we observed contraction of cerebral capillaries induced by radiation, and radiation could further result in cerebral capillaries network

simplification over time. Initial studies demonstrated that fractionated radiotherapy induced a rarefaction of vessels within the Cornu Ammonis 1(CA1), Cornu Ammonis 3(CA3) and dentate

gyrus region of the hippocampus (an area important for spatial memory), which is closely related to supply of oxygen, nutrients and trophic factors to brain, and thus result in deficits in

spatial learning and memory38. However, in some mouse radiation damage models, the blood perfusion of tissue cannot be accurately assessed, and the damage of vascular function cannot be

evaluated at the whole brain level. In addition, the tissue fixation and section staining would alter the vascular structure. Meanwhile, because of the relatively low resolution of CTA and

MRA for human patients, morphological and functional changes of micro vessels after radiation could not be detected either. In our study, the whole brain of transgenic zebrafish can be

directly imaged under a fluorescent microscope or confocal due to their small size and transparency. Therefore, using zebrafish radiation model, the 3-D _in vivo_ tracking of brain

vasculature provides chances for us to preciously evaluate the cerebral endothelium and blood perfusion after exposing to ionize radiation. The molecular mechanism of cerebral vascular

damage by ionizing radiation is still controversial. Radiation could induce the damage of DNA followed by increased expression of apoptosis signals in many vascular endothelial cells,

resulting in angiogenesis compromise14, which is partially consistent with our results. The DNA damage response coordinates many processes, including DNA repair, regulation of cell cycle

checkpoints, and ultimately induction of a programmed cell death, most often apoptosis, when DNA damage cannot be repaired. Many researchers suggest, that autophagy, a catabolic process

considered to be a cellular survival mechanism, is a central player in the regulation of DNA damage response. For mild stress, activation of DNA damage response may evoke autophagy as an

early adaptive response. For serious stress, such as radiotherapy, autophagy did not promote survival, but induced apoptosis. We found that the apoptosis of endothelial cells increased to 8%

after radiation compared with control group (2%) in zebrafish brain. Besides, the strongly upregulation of autophagy genes39, including atg5, beclin-1, LC3 and ambra1, demonstrate that the

endothelial autophagy is activated by ionizing radiation. To lively image the radiated-induced endothelial autophagy in zebrafish, we establish the fli:mCherry-GFP-LC3 transgenic zebrafish

to monitor the autophagy process specifically in endothelial cells after X-ray radiation. Interestingly, our results demonstrated that radiation could lead to acceleration of autophagic flux

and apoptosis in cerebral endothelial cells (Fig. 5). However, in an _in vitro_ study, Kalamida _et al_. found ionizing radiation could trigger perinuclear accumulation of the

autophagosomal proteins and repression of the autophagolysosomal flux in human umbilical vein endothelial cells, suggesting against the blockage of autophagic flux may contribute to

radio-resistance40,41. The difference might owe to the difference between _in vivo_ and _in vitro_ studies, and different radiation dosage and animal models. Autophagy is a highly conserved

cytoprotective and complex process, and several pharmacological and nutritional interventions are available to inhibit autophagy at the nucleation, elongation, fusion or degradation phase.

Although chloroquine, ly294002 and wortamannin are all considered as autophagy inhibitors, each functions differently in the autophagy process. Chloroquine42 is a inhibitor of lysosomal

function, ly29400243 is VPS34 inhibitor, and they can pass through blood-brain barrier. Compared with ly294002, wortamannin44 had no blood-brain barrier permeant and had relatively bad

selectivity. Although chloroquine and ly294002 are able to significantly repress the formation of autophagosomes in the cerebral endothelium, they had systemically toxic to zebrafish.

Commercial autophagy drug library contains hundreds of autophagy related compounds. Take advantage of the high throughput drug screening ability of zebrafish model, we may find an autophagy

inhibitor that could significantly alleviate the radiation-induced cerebral vascular damage but has relatively low toxicity in the future. Our study also had some limitations. For instance,

in our current study, the major molecular mechanism of radiation induced vascular damage was tested in zebrafish model, which should be further tested in mammals and human cerebral

endothelial cells. In addition, because of the tiny size of zebrafish, the same dose of radiation in zebrafish might be different in patients, which need to further addressed in the

following studies. Despite these limitations, it was the first time that revealing the radiation-induced morphological change of cerebral vessels at the whole-brain level. We also tested a

mechanism of radiation-induced endothelial damage in transgenic zebrafish model, suggesting a novel therapeutic strategy for radiation-induced cerebral vascular damage. REFERENCES *

Greene-Schloesser, D., Moore, E. & Robbins, M. E. Molecular pathways: radiation-induced cognitive impairment. _Clin. Cancer Res._ 19, 2294–2300,

https://doi.org/10.1158/1078-0432.CCR-11-2903 (2013). Article  CAS  PubMed  PubMed Central  Google Scholar  * Greene-Schloesser, D. _et al_. Radiation-induced brain injury: A review. _Front.

Oncol._ 2, 73, https://doi.org/10.3389/fonc.2012.00073 (2012). Article  CAS  PubMed  PubMed Central  Google Scholar  * McTyre, E., Scott, J. & Chinnaiyan, P. Whole brain radiotherapy

for brain metastasis. _Surgical Neurol. Int._ 4, S236–244, https://doi.org/10.4103/2152-7806.111301 (2013). Article  Google Scholar  * Lippitz, B. _et al_. Stereotactic radiosurgery in the

treatment of brain metastases: the current evidence. _Cancer Treat. Rev._ 40, 48–59, https://doi.org/10.1016/j.ctrv.2013.05.002 (2014). Article  PubMed  Google Scholar  * Khuntia, D., Brown,

P., Li, J. & Mehta, M. P. Whole-brain radiotherapy in the management of brain metastasis. _J. Clin. Oncol._ 24, 1295–1304, https://doi.org/10.1200/JCO.2005.04.6185 (2006). Article  CAS

  PubMed  Google Scholar  * Pease, N. J., Edwards, A. & Moss, L. J. Effectiveness of whole brain radiotherapy in the treatment of brain metastases: a systematic review. _Palliat. Med._

19, 288–299, https://doi.org/10.1191/0269216305pm1017oa (2005). Article  CAS  PubMed  Google Scholar  * Davis, C. M. _et al_. Effects of X-ray radiation on complex visual discrimination

learning and social recognition memory in rats. _PLoS one_ 9, e104393, https://doi.org/10.1371/journal.pone.0104393 (2014). Article  ADS  CAS  PubMed  PubMed Central  Google Scholar  *

Schultheiss, T. E. & Stephens, L. C. Invited review: permanent radiation myelopathy. _Br. J. Radiol._ 65, 737–753, https://doi.org/10.1259/0007-1285-65-777-737 (1992). Article  CAS 

PubMed  Google Scholar  * Attia, A., Page, B. R., Lesser, G. J. & Chan, M. Treatment of radiation-induced cognitive decline. _Curr. Treat. Options Oncol._ 15, 539–550,

https://doi.org/10.1007/s11864-014-0307-3 (2014). Article  PubMed  Google Scholar  * Kovacs, R., Heinemann, U. & Steinhauser, C. Mechanisms underlying blood-brain barrier dysfunction in

brain pathology and epileptogenesis: role of astroglia. _Epilepsia_ 53(Suppl 6), 53–59, https://doi.org/10.1111/j.1528-1167.2012.03703.x (2012). Article  CAS  PubMed  Google Scholar  *

Abbott, N. J. & Friedman, A. Overview and introduction: the blood-brain barrier in health and disease. _Epilepsia_ 53(Suppl 6), 1–6, https://doi.org/10.1111/j.1528-1167.2012.03696.x

(2012). Article  PubMed  PubMed Central  Google Scholar  * Dimitrievich, G. S., Fischer-Dzoga, K. & Griem, M. L. Radiosensitivity of vascular tissue. I. Differential radiosensitivity of

capillaries: a quantitative _in vivo_ study. _Radiat. Res._ 99, 511–535 (1984). Article  ADS  CAS  PubMed  Google Scholar  * Belka, C., Budach, W., Kortmann, R. D. & Bamberg, M.

Radiation induced CNS toxicity–molecular and cellular mechanisms. _Br. J. Cancer_ 85, 1233–1239, https://doi.org/10.1054/bjoc.2001.2100 (2001). Article  CAS  PubMed  PubMed Central  Google

Scholar  * Ungvari, Z. _et al_. Ionizing radiation promotes the acquisition of a senescence-associated secretory phenotype and impairs angiogenic capacity in cerebromicrovascular endothelial

cells: role of increased DNA damage and decreased DNA repair capacity in microvascular radiosensitivity. _J. Gerontol. A Biol. Sci. Med. Sci_ 68, 1443–1457,

https://doi.org/10.1093/gerona/glt057 (2013). Article  CAS  PubMed  PubMed Central  Google Scholar  * Ruben, J. D. _et al_. Cerebral radiation necrosis: incidence, outcomes, and risk factors

with emphasis on radiation parameters and chemotherapy. _Int. J. Radiat. oncology, biology, Phys._ 65, 499–508, https://doi.org/10.1016/j.ijrobp.2005.12.002 (2006). Article  ADS  Google

Scholar  * Li, Y. Q., Chen, P., Haimovitz-Friedman, A., Reilly, R. M. & Wong, C. S. Endothelial apoptosis initiates acute blood-brain barrier disruption after ionizing radiation. _Cancer

Res._ 63, 5950–5956 (2003). CAS  PubMed  Google Scholar  * Li, Y. Q., Chen, P., Jain, V., Reilly, R. M. & Wong, C. S. Early radiation-induced endothelial cell loss and blood-spinal cord

barrier breakdown in the rat spinal cord. _Radiat. Res._ 161, 143–152 (2004). Article  ADS  CAS  PubMed  Google Scholar  * Shi, L. _et al_. Spatial learning and memory deficits after

whole-brain irradiation are associated with changes in NMDA receptor subunits in the hippocampus. _Radiat. Res._ 166, 892–899, https://doi.org/10.1667/RR0588.1 (2006). Article  ADS  CAS 

PubMed  Google Scholar  * Wilkinson, R. N. & van Eeden, F. J. The zebrafish as a model of vascular development and disease. _Prog. Mol. Biol. Transl. Sci._ 124, 93–122,

https://doi.org/10.1016/B978-0-12-386930-2.00005-7 (2014). Article  CAS  PubMed  Google Scholar  * Duboc, V., Dufourcq, P., Blader, P. & Roussigne, M. Asymmetry of the Brain: Development

and Implications. _Annu. Rev. Genet._ 49, 647–672, https://doi.org/10.1146/annurev-genet-112414-055322 (2015). Article  CAS  PubMed  Google Scholar  * Kwan, K. M. _et al_. The Tol2kit: a

multisite gateway-based construction kit for Tol2 transposon transgenesis constructs. _Dev. Dyn._ 236, 3088–3099, https://doi.org/10.1002/dvdy.21343 (2007). Article  CAS  PubMed  Google

Scholar  * Westerfield, M. _The zebrafish book: a guide for the laboratory use of zebrafish (Danio rerio)_. (Inst Of Neuro Science, 2007). * Piao, W. _et al_. Development of azo-based

fluorescent probes to detect different levels of hypoxia. _Angew. Chem. Int. Ed. Engl._ 52, 13028–13032, https://doi.org/10.1002/anie.201305784 (2013). Article  CAS  PubMed  Google Scholar 

* Blacker, T. S. _et al_. Separating NADH and NADPH fluorescence in live cells and tissues using FLIM. _Nat. Commun._ 5, 3936, https://doi.org/10.1038/ncomms4936 (2014). Article  ADS  CAS 

PubMed  Google Scholar  * Zembruski, N. C., Stache, V., Haefeli, W. E. & Weiss, J. 7-Aminoactinomycin D for apoptosis staining in flow cytometry. _Anal. Biochem._ 429, 79–81,

https://doi.org/10.1016/j.ab.2012.07.005 (2012). Article  CAS  PubMed  Google Scholar  * Hwang, M., Yong, C., Moretti, L. & Lu, B. Zebrafish as a model system to screen radiation

modifiers. _Curr. Genomics_ 8, 360–369, https://doi.org/10.2174/138920207783406497 (2007). Article  CAS  PubMed  PubMed Central  Google Scholar  * Evans, N. D., Gnudi, L., Rolinski, O. J.,

Birch, D. J. & Pickup, J. C. Non-invasive glucose monitoring by NAD(P)H autofluorescence spectroscopy in fibroblasts and adipocytes: a model for skin glucose sensing. _Diabetes Technol.

Ther._ 5, 807–816, https://doi.org/10.1089/152091503322527012 (2003). Article  CAS  PubMed  Google Scholar  * Bickler, P. E. & Donohoe, P. H. Adaptive responses of vertebrate neurons to

hypoxia. _J. Exp. Biol._ 205, 3579–3586 (2002). CAS  PubMed  Google Scholar  * Lipton, P. Ischemic cell death in brain neurons. _Physiol. Rev._ 79, 1431–1568 (1999). Article  CAS  PubMed 

Google Scholar  * Paglin, S. _et al_. A novel response of cancer cells to radiation involves autophagy and formation of acidic vesicles. _Cancer Res._ 61, 439–444 (2001). CAS  PubMed  Google

Scholar  * Liu, Y. & Levine, B. Autosis and autophagic cell death: the dark side of autophagy. _Cell Death Differ._ 22, 367–376, https://doi.org/10.1038/cdd.2014.143 (2015). Article 

CAS  PubMed  Google Scholar  * Kimura, S., Noda, T. & Yoshimori, T. Dissection of the autophagosome maturation process by a novel reporter protein, tandem fluorescent-tagged LC3.

_Autophagy_ 3, 452–460 (2007). Article  CAS  PubMed  Google Scholar  * Pankiv, S. _et al_. p62/SQSTM1 binds directly to Atg8/LC3 to facilitate degradation of ubiquitinated protein aggregates

by autophagy. _J. Biol. Chem._ 282, 24131–24145, https://doi.org/10.1074/jbc.M702824200 (2007). Article  CAS  PubMed  Google Scholar  * Kroemer, G. & Levine, B. Autophagic cell death:

the story of a misnomer. _Nat. Rev. Mol. Cell Biol._ 9, 1004–1010, https://doi.org/10.1038/nrm2529 (2008). Article  CAS  PubMed  PubMed Central  Google Scholar  * Blommaart, E. F., Krause,

U., Schellens, J. P., Vreeling-Sindelarova, H. & Meijer, A. J. The phosphatidylinositol 3-kinase inhibitors wortmannin and LY294002 inhibit autophagy in isolated rat hepatocytes. _Eur.

J. Biochem._ 243, 240–246 (1997). Article  CAS  PubMed  Google Scholar  * Shintani, T. & Klionsky, D. J. Autophagy in health and disease: a double-edged sword. _Science_ 306, 990–995,

https://doi.org/10.1126/science.1099993 (2004). Article  ADS  CAS  PubMed  PubMed Central  Google Scholar  * Ljubimova, N. V., Levitman, M. K., Plotnikova, E. D. & Eidus, L. Endothelial

cell population dynamics in rat brain after local irradiation. _Br. J. Radiol._ 64, 934–940, https://doi.org/10.1259/0007-1285-64-766-934 (1991). Article  CAS  PubMed  Google Scholar  *

Warrington, J. P. _et al_. Cerebral microvascular rarefaction induced by whole brain radiation is reversible by systemic hypoxia in mice. _Am. J. Physiol. Heart Circ. Physiol_ 300, H736–744,

https://doi.org/10.1152/ajpheart.01024.2010 (2011). Article  CAS  PubMed  Google Scholar  * Marino, G., Niso-Santano, M., Baehrecke, E. H. & Kroemer, G. Self-consumption: the interplay

of autophagy and apoptosis. _Nat. Rev. Mol. Cell Biol._ 15, 81–94, https://doi.org/10.1038/nrm3735 (2014). Article  CAS  PubMed  PubMed Central  Google Scholar  * Kalamida, D., Karagounis,

I. V., Giatromanolaki, A. & Koukourakis, M. I. Important role of autophagy in endothelial cell response to ionizing radiation. _PLoS one_ 9, e102408,

https://doi.org/10.1371/journal.pone.0102408 (2014). Article  ADS  PubMed  PubMed Central  Google Scholar  * McRobb, L. S. _et al_. Ionizing radiation reduces ADAM10 expression in brain

microvascular endothelial cells undergoing stress-induced senescence. _Aging (Albany NY.)_ 9, 1248–1268, https://doi.org/10.18632/aging.101225 (2017). Article  CAS  Google Scholar  * Cui, C.

M. _et al_. Chloroquine exerts neuroprotection following traumatic brain injury via suppression of inflammation and neuronal autophagic death. _Mol. Med. Rep._ 12, 2323–2328,

https://doi.org/10.3892/mmr.2015.3611 (2015). Article  CAS  PubMed  Google Scholar  * Cui, D. R. _et al_. Propofol prevents cerebral ischemia-triggered autophagy activation and cell death in

the rat hippocampus through the NF-kappaB/p53 signaling pathway. _Neuroscience_ 246, 117–132, https://doi.org/10.1016/j.neuroscience.2013.04.054 (2013). Article  CAS  PubMed  Google Scholar

  * Zhao, H. _et al_. Role of autophagy in early brain injury after subarachnoid hemorrhage in rats. _Mol. Biol. Rep._ 40, 819–827, https://doi.org/10.1007/s11033-012-2120-z (2013). Article

  CAS  PubMed  Google Scholar  Download references ACKNOWLEDGEMENTS We thank Wusheng Tang for the zebrafish husbandry. This work was supported by grants from the National Natural Science

Foundation of China (Grant no. 81703064; 81773097; 81872068; 81872391). This work was supported by grants from the National Natural Science Foundation of China (Grant no. 81703064; 81773097;

81872068; 81872391;81872466). AUTHOR INFORMATION Author notes * These authors contributed equally: Xiaolin Ai and Zengpanpan Ye. AUTHORS AND AFFILIATIONS * State Key Laboratory of

Biotherapy and Cancer Center, West China Hospital, Sichuan University, and Collaborative Innovation Center for Biotherapy, Chengdu, Sichuan, P. R. China Xiaolin Ai, Zengpanpan Ye, Xi Huang, 

Jian Zhong & Chengjian Zhao * Department of Neurosurgery, West China Hospital, Sichuan University, Chengdu, Sichuan, P. R. China Xiaolin Ai, Zengpanpan Ye, Chao You & Jianguo Xu *

West China School of Public Health, No.4 West China Teaching Hospital, Sichuan University, Chengdu, Sichuan, P. R. China Yuqin Yao, Xuejiao Song & Huashan Shi * State Key Laboratory of

Biotherapy and Department of Head and Neck Oncology, West China Hospital, West China Medical School, Sichuan University, Chengdu, Sichuan, P. R. China Jianghong Xiao * Department of Imaging,

West China Hospital of Sichuan University, Chengdu, Sichuan, P. R. China Min Fan * Department of Gynecology and Obstetrics, State Key Laboratory of Biotherapy, West China Second University

Hospital, Sichuan University and Collaborative Innovation Center for Biotherapy, Chengdu, China Dongmei Zhang Authors * Xiaolin Ai View author publications You can also search for this

author inPubMed Google Scholar * Zengpanpan Ye View author publications You can also search for this author inPubMed Google Scholar * Yuqin Yao View author publications You can also search

for this author inPubMed Google Scholar * Jianghong Xiao View author publications You can also search for this author inPubMed Google Scholar * Chao You View author publications You can also

search for this author inPubMed Google Scholar * Jianguo Xu View author publications You can also search for this author inPubMed Google Scholar * Xi Huang View author publications You can

also search for this author inPubMed Google Scholar * Jian Zhong View author publications You can also search for this author inPubMed Google Scholar * Min Fan View author publications You

can also search for this author inPubMed Google Scholar * Xuejiao Song View author publications You can also search for this author inPubMed Google Scholar * Huashan Shi View author

publications You can also search for this author inPubMed Google Scholar * Dongmei Zhang View author publications You can also search for this author inPubMed Google Scholar * Chengjian Zhao

View author publications You can also search for this author inPubMed Google Scholar CONTRIBUTIONS C.J.Z., X.L.A., H.S.S. and C.Y. conceived the initial concept for the study. C.J.Z.,

X.L.A., H.S.S. and J.G.X. designed the study. X.L.A., Z.P.P.Y., C.J.Z., H.S.S., Y.Q.Y., J.H.X., J.Z., D.M.Z. and X.H. carried out the experiments. C.J.Z. and Z.P.P.Y. wrote the manuscript.

M.F., Z.P.P.Y. and X.J.S. revised the manuscript. CORRESPONDING AUTHORS Correspondence to Dongmei Zhang or Chengjian Zhao. ETHICS DECLARATIONS COMPETING INTERESTS The authors declare no

competing interests. ADDITIONAL INFORMATION PUBLISHER’S NOTE Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION. RIGHTS AND PERMISSIONS OPEN ACCESS This article is licensed under a Creative Commons Attribution 4.0 International License, which permits

use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the

Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated

otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds

the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Reprints and

permissions ABOUT THIS ARTICLE CITE THIS ARTICLE Ai, X., Ye, Z., Yao, Y. _et al._ Endothelial Autophagy: an Effective Target for Radiation-induced Cerebral Capillary Damage. _Sci Rep_ 10,

614 (2020). https://doi.org/10.1038/s41598-019-57234-9 Download citation * Received: 26 March 2019 * Accepted: 11 December 2019 * Published: 17 January 2020 * DOI:

https://doi.org/10.1038/s41598-019-57234-9 SHARE THIS ARTICLE Anyone you share the following link with will be able to read this content: Get shareable link Sorry, a shareable link is not

currently available for this article. Copy to clipboard Provided by the Springer Nature SharedIt content-sharing initiative