Genome-wide analysis shows that rnase g plays a global role in the stability of mrnas in stenotrophomonas maltophilia

ABSTRACT Gene expression is determined by critical processes such as RNA synthesis and degradation. Ribonucleases participate in the coordinated and differential decay of messenger RNAs. We

describe a suitable method of normalization and calculation of mRNAs half-life values quantified by RNA-Seq. We determined the mRNA half-lives of more than 2000 genes in _Stenotrophomonas

maltophilia_ D457 and in an isogenic RNase G deficient mutant. Median half-lives were 2,74 and 3 min in the wild-type and the _rng_-deficient strain, respectively. The absence of RNase G

resulted in an overall enhancement of mRNA half-life times, showing that many RNAs are targets of RNase G in _S. maltophilia_. Around 40 genes are likely to be regulated directly by RNase G

since their half-lives were more than two-fold higher in the _rng_-deficient mutant. Gene length, GC content or expression levels did not correlate with mRNAs lifetimes, although groups of

genes with different functions showed different RNA half-lives. Further, we predicted 1542 gene pairs to be part of the same operons in _S. maltophilia_. In contrast to what was described

for other bacteria, our data indicate that RNase G has a global role in mRNA stability and consequently in the regulation of _S. maltophilia_ gene expression. SIMILAR CONTENT BEING VIEWED BY

OTHERS A SYSTEMATIC SEARCH FOR RNA STRUCTURAL SWITCHES ACROSS THE HUMAN TRANSCRIPTOME Article Open access 16 July 2024 GRANDR: A COMPREHENSIVE PACKAGE FOR NUCLEOTIDE CONVERSION RNA-SEQ DATA

ANALYSIS Article Open access 15 June 2023 SCREENING THOUSANDS OF TRANSCRIBED CODING AND NON-CODING REGIONS REVEALS SEQUENCE DETERMINANTS OF RNA POLYMERASE II ELONGATION POTENTIAL Article 09

June 2022 INTRODUCTION The expression of a gene is a dynamic process that is regulated at several levels (i.e. the transcription initiation, RNA processing and degradation, translation, and

the processing and degradation of the protein product). Alteration in the rate of messenger decay is thus an important factor in the regulation of a gene’s steady-state mRNA expression

level1,2, hence allowing bacterial adaptation to changing environmental conditions. The degradation of any mRNA may be influenced by various factors including its secondary structure and its

rate of translation. These parameters can be affected by RNA-binding proteins and by regulatory RNAs. Therefore, it was suggested that a basal decay rate is mainly dictated by the mRNA

molecule itself3,4,5,6. In addition, different RNases can degrade specific mRNAs, hence allowing a more functional-based regulation of RNA decay. The molecular machinery of mRNA turnover

differs between pathogenic bacteria and their eukaryote hosts, suggesting that these differences could be used to define novel targets for the development of new antimicrobial drugs7.

_Escherichia. coli_ is the best studied model microorganism for analysing mRNA decay. Many enzymes, including those forming part of the RNA degradosome (a multisubunit protein complex that

functions as endoribonuclease and 3´-exoribonuclease) participate in the degradation of mRNA in _E. coli_ and in Gram-negative bacteria in general8. RNase E is an essential endonuclease that

forms part of the RNA degradosome8 and plays an important role in RNA metabolism in many bacteria9. Other independent endoribonucleases contribute to the turnover of mRNAs, as RNase G,

RNase I and RNase III10,11,12. _E. coli_ RNase G is an endonuclease possessing ∼50% sequence similarity to the RNase E catalytic region and overlapping, but not identical, cleavage

specificity13,14,15. RNase G is found in Gram-negative pathogen microorganisms such as _Klebsiella pneumoniae_, _Acinetobacter baumannii_, _Pseudomonas aeruginosa_, _Enterobacter cloacae_

and _E. coli_, and is not an essential protein16. RNase E and RNase G are present in _Stenotrophomonas maltophilia_ 17. RNases G from _E. coli_ and _S. maltophilia_ have not significant

differences in domains, sequence or length, except for few differences in single amino acids. We have previously shown that the absence of RNase G is associated with increased resistance to

quinolones and with the overexpression of genes involved in the _S. maltophilia_ heat shock response18, indicating that RNase G might be involved in the cellular response to stress. _S.

maltophilia_ is an opportunistic pathogen, associated with nosocomial infections, which presents a low level of susceptibility to several antibiotics, including quinolones19. The low

susceptibility of this pathogen is partly due to the presence in its genome of genes encoding a wide range of resistance determinants18,20,21,22,23,24,25,26,27,28. Although during the past

years much knowledge on the genomic structure complexity of _S. maltophilia_ was obtained, transcriptomic studies and mRNA degradation studies were not performed in this microorganism.

During the past decade, microarray technology was a useful tool for studies on global mRNA decay in a wide range of different organisms3,29,30. However, high throughput RNA sequencing

(RNA-Seq) has much higher resolution and accuracy than microarrays. Some studies have performed genome-wide analysis of mRNA decay at single nucleotide resolution using RNA sequencing mostly

in _E. coli_ and in species of the _Bacillus_ genus5,31,32,33. We present here a genome-wide analysis of mRNA decay using RNA-Seq in _S. maltophilia_ and provide a suitable method for

normalization and calculation of mRNAs half-life values. We report mRNA half-lives of more than 2000 genes in the _S. maltophilia_ wild-type clinical strain D457 as well as in its isogenic

_rng_-defective mutant ALB001. Further, the comparison of mRNA decay in both strains allowed us to find targets of RNase G and to analyse the correlation of mRNA half-lives with gene

characteristics and functions. RESULTS DATA ANALYSIS AND MAPPING OF SEQUENCE READS Mid-log cultures of the _S. maltophilia_ wild-type strain (D457) and a RNase G deficient strain (ALB001)

were subjected to transcriptional arrest by rifampicin34, and RNA was isolated 0, 5, 10 and 15 min after rifampicin addition. The use of rRNA as reference for the RT-qPCR-based mRNA decay

experiments was validated by measuring the transcript decay 15 min after rifampicin addition (Figure S1), confirming that 16S rRNA was not detectably degraded. In all cases, the mean values

for relative mRNA expression obtained in two independent experiments, each one with two technical replicates were considered. To validate the decrease of mRNA levels as a function of time

after rifampicin addition, the expression of _groES_ and _groEL_ was determined by RT-qPCR (Fig. 1). There was a 17 to 18- and 10 to 14 -fold decrease of _groES_ and _groEL_ mRNA levels,

respectively, after 15 min of rifampicin addition. The mRNA decay of these genes illustrated the efficiency of mRNA run-out after rifampicin addition. For these analysed messengers, the RNA

decay fits well with the logarithmic regression model described in Methods (R2 = 0,99 in all cases). Following rRNA depletion, mRNA levels of all genes were determined by RNA sequencing (see

Methods). After removing the adapter oligonucleotides with Ampure beads, cDNA samples were deep sequenced using the Illumina technology. Quality analysis of sequenced samples showed that

25% of the reads are over-represented (Table 1). Further refinement of the data was carried out to assure that these over-represented sequences are free from adapter and rRNA sequences.

Samples were subjected to sequence trimming and quality filtering (Table 2). Just between 0.2 and 2.6% of over-represented reads were adapters, and consequently, they were removed from the

analysis. The rest of abundant sequences could correspond to highly expressed genes as well as to multiple-copy genes, such as those encoding rRNAs and tRNAs. Indeed, just between 0.8 and

2.3% of the reads after discarding the adapters were sequences mapping to multiple positions in the genome, indicating that most of the over-represented sequences corresponded to _S.

maltophilia_ highly expressed genes. The low number of reads that mapped to multiple positions in the genome and the verification that most of them belong to tRNAs (data not shown) reflected

a successful removal of rRNA molecules. The ORFs encoding tRNAs or ncRNA were not included in the analysis. After trimming and filtering procedures, nearly 6 out of more than 12 million

reads (46%) and 7 out of 11 million reads (63%) produced by Illumina sequencing from _S. maltophilia_ D457 and ALB001 strains, respectively, were unambiguously mapped -matched in a single

position- to the _S. maltophilia_ D457 annotated genome (Table 2). NORMALIZATION OF THE DATA To investigate the progressive decline of mRNA in _S. maltophilia_ and the influence of RNase G

in such decay, we performed a genome-wide determination of mRNA half-lives in the _S. maltophilia_ wild-type D457 strain and the _S. maltophilia_ D457 _rng_-insertion mutant ALB001 by

RNA-Seq. Since variation in sequencing effectiveness, variable effectiveness in rRNA depletion or multiple sequencing of some samples could lead to sample-to-sample variation, normalization

of the data was required. For this, we calculated by RT-qPCR (see Methods for details) the decay rate of _groES_, which presents a high expression level, as estimated by its reads per

kilobase per million mapped reads (RPKM) value in mid-exponential phase and we used the _groES_ RT-qPCR obtained expression data for normalization. The use of a similar methodology for

normalization of RNA-Seq data was reported before31. _groES_ RNA degradation was similar in D457 and ALB001 strains and there were no significant differences (_p_ > 0,05) in the relative

amount of RNA at any of the time points (Fig. 1). To test the validity of the normalization procedure, the half-lives of four mRNAs were determined for the D457 strain. When comparing the

half-lives of these mRNAs, estimated either by RT-qPCR or by using the information derived from the RNA-Seq analysis, a Pearson correlation coefficient of 0.96 was obtained (Table 3). The

reproducibility of the decline rates obtained by using independently both methods indicates that RNA-Seq, together with the normalization procedure of the data before described, is a

suitable method for calculating mRNA half-lives in _S. maltophilia_. GENOME-WIDE DETERMINATION OF MRNA DECAY RATES IN _S. MALTOPHILIA_ D457 AND ALB001 Using the above described approach, we

could determine the half-lives of 2674 mRNAs in D457, and 2449 in _S. maltophilia_ ALB001. The half-lives of 2179 mRNAs were determined in both strains. Table 4 shows an overall review of

the mRNA half-lives calculated for both strains, Fig. 2 shows the distribution of the mRNA half-lives calculated, and Table S1 (Supplemental material) shows a list of all mRNA half-lives.

Half-lives had median values of 2.74 and 3 min and mean values of 2.88 and 3.24 min in D457 and ALB001 strain respectively (Table 4). In _S. maltophilia_ D457, half of the estimated

half-life values ranged between 2.39 and 3.23 min, while in the _rng_ deficient _S. maltophilia_ strain ALB001, half of the estimated half-lives values ranged between 2.51 and 3.67 min (Fig.

 2). The shortest half-live observed in D457 was 1.08 min for SMD_3475 that codifies azurin and constitutes the only outlier of the lower limit. The shortest half-life observed in ALB001 was

1.34 min for _lspA_, which encodes the lipoprotein signal peptidase. SMD_3475 mRNA has a much higher half-life in the ALB001 mutant (2.74 min) than in the wild-type strain, indicating that

RNase G is likely involved in its processing. In contrast, the _lspA_ mRNA has similar half-lives in both strains, suggesting that RNase G has no role in its degradation. It should be noted

that RNAs with extremely short half-lives are most likely excluded in the analysis because their fast degradation hampers the adjustment of the data to the logarithmic regression model, and

they are discarded in the filtering. In _S. maltophilia_ D457, 79 mRNAs showed half-lives longer than 4.49 minutes, the top whisker of the distribution. In ALB001, 86 mRNAs showed half-lives

longer than 5.4 minutes, 47 of which are the same as in D457. These genes present the highest mRNA half-lives of all the set and are outliers of the distribution in Fig. 2 (see Table S1 for

mRNA half-lives). By determining RNA half-lives of more than 2000 genes we observed that deficiency of RNase G affects normal lifetimes of mRNAs since general parameters are higher and

overall distribution of mRNA half-lives is different in the _rng_-deficient mutant regarding to D457 wild-type strain. OPERON PREDICTION Multi-gene operons were predicted from our RNA-Seq

data by Rockhopper software. The operons are predicted by the distance of CDS in genome and by their data of expression in all the samples. In our RNA-Seq data from _S. maltophilia_, 1542

gene-pairs were predicted to be part of the same operons and 808 likely belong to multi-genes operons. Table S2 shows a list of genes grouped by their predicted operon, their RNA half-lives

and their RPKM at the first time point of the experiment. RNAs of genes present in the same operon have to a certain degree similar half-lives. RNAs of the predicted operons

SMD_4075/SMD_4076 and SMD_4077/SMD_4078 have very long half-lives in both strains and similar expression, and RNAs of predicted operon SMD_3354/SMD_3355 have short half-lives and high

expression, making very likely that these gene-pairs are part of the same double-gene operon. However other RNAs of genes included in the same predicted operon have different half-lives,

which may be due to an unequal degradation and regulation of the messenger molecule. A predicted triple-gene operon contained SMD_3812, _groEL_ and _groES_ genes. These genes presented

similar RNA half-lives, but _groEL_ and _groES_ expression was much higher than SMD_3812 expression. Interestingly, the RNA half-lives of these genes were more variable in the ALB001 mutant

than in the D457 wild-type strain. RNAs of genes included in the same predicted multi-gene operon had more variable half-lives in ALB001 than in D457, suggesting a deficiency in the correct

timing of RNA degradation when RNase G is absent. ROLE OF GENE SEQUENCE AND EXPRESSION LEVELS IN MRNA HALF-LIFE We investigated how different parameters of _S. maltophilia_ genes may

influence mRNA decay rates in _S. maltophilia_ D457. We evaluated the influence of the level of expression of the genes in mid-exponential phase (transcriptome accession number

SRR212815618), and sequence attributes of the CDS as the gene GC percentage and the length of the ORF (Fig. 3). None of the parameters tested here showed a correlation with the mRNA

half-live values, meaning that in _S. maltophilia_ the rate of decay of a mRNA is not dependent on its level of expression, its GC content or its gene length. However, GC content may

influence the level of expression of a gene negatively (Fig. 3D), since there is a weak negative linear relationship between the expression level of genes and their GC content (R2 = 0,14).

We did not detect any relevant bias in coverage depending on the GC content when the whole genome of different _S. maltophilia_ D457 mutants is sequenced35. MESSENGER RNA HALF-LIVES AND THE

BIOLOGICAL ROLE OF THE GENE An analysis of genes grouped by their catalytic functions was carried out to determine if the involvement of a gene in a specific biological process influences

the half-life of its mRNA in _S. maltophilia_ D457. For this, we used the EC classification of enzymes (Enzyme Committee by the International Union of Biochemistry and Molecular Biology,

http://www.chem.qmul.ac.uk/iubmb/enzyme/) to sort the genes of _S. maltophilia_ genome, and CDS were grouped by categories and subcategories (Tables S3 and S4). Five hundred and forty genes

were used for this study, some of which were classified in more than one subcategory (Fig. 4). Statistical analysis of the distribution of mRNA half-lives is shown in Table S5. Groups of

genes whose products encode proteins involved in stress response; cofactors; nucleosides and nucleotides and regulation and cell signalling were associated with longer half-lives. Classes

containing gene products involved in respiration; virulence, disease and defence; fatty acids and lipids; cell wall and capsule and carbohydrates were among those with the shortest

half-lives (Fig. 4). However, by grouping genes in subcategories, some subgroups from different categories showed the longest half-lives, such as the subcategories riboflavin, FMN and FAD;

oxidative stress and DNA repair (Table S3). In contrast, the subcategory of genes encoding proteins involved in electron donating reactions had the mRNAs’ shortest half-lives, as well as the

genes involved in capsular and extracellular polysaccharide synthesis, monosaccharides metabolism and fatty acids synthesis. By analysing genes in subcategories, we could discriminate more

specifically which groups of genes in each of the categories have the longest or the shortest half-life. This analysis suggests that, at least some mRNA half-lives, may have been selected

depending on the functional role of the enzyme that the messengers encode. EFFECT OF RNASE G IN _S. MALTOPHILIA_ MRNA STABILITY To determine the potential mRNA targets of RNase G we have

analysed the transcripts presenting higher mRNA half-lives in the _rng_-deficient _S. maltophilia_ strain ALB001 than in the wild-type strain. The overall distribution of mRNA half-life

values is different in ALB001 vs. D457. Fifty percent of the mRNA half-lives are in a narrower range in D457 than in ALB001 (0.84 and 1.16 interquartile range for D457 and ALB001

respectively) and they are overall higher in ALB001 than in D457 (Fig. 2). However, a comparison of mRNA half-lives in the two strains showed a correlation of 0.45 (Fig. 5) meaning that many

mRNAs have different half-lives in one and in the other strain, although they have a positive linear relationship. As expected, in mutant ALB001 mRNA half-lives are generally higher than in

the wild-type D457 strain. Indeed, Fig. 2 shows that there is a shift in values of mRNA half-lives in the mutant lacking _rng_ as compared with these from the wild-type strain D457. As

stated before, statistical quantifiers as median, mean and quartiles are higher in the case of the distribution of mRNAs half lives from of ALB001 than in the case of D457 (Fig. 2 and Table 

4). Together, these data support an overall increase of half-life times of mRNAs in _S. maltophilia_ when RNase G is absent. In addition to this general trend, the stability of some mRNAs is

largely improved in the ALB001 mutant. Indeed, 43 genes presented at least a 100% increase in their mRNA half-lives in the ALB001 mutant as compared with the wild-type D457 strain (Table 

S1). Among these genes, we can highlight 3 transcriptional regulators belonging to the LysR (SMD_0469), TetR (SMD_2350) and PadR (SMD_1499) families, a carbon storage regulator (SMD_1681),

one DNA (SMD_2009) and one RNA binding protein (SMD_1667), one DNA-binding response regulator (SMD_1260) and a copper resistance protein (SMD_1486). However, most of the mRNAs presenting

substantially higher half-lives in the ALB001 mutant than in the wild-type D457 strain, encode proteins with unknown function. To further verify the effect of RNase G deficiency over RNA

stability of specific genes we studied by RT-qPCR the RNA levels of two genes, SMD_2876 and SMD_0264 that presented double RNA half-lives in ALB001 than in D457 by RNA-Seq analysis. In

agreement with RNA-Seq results, RNA half-lives are about two-fold higher in ALB001 than in D457 strain for both genes (Figure S2). These data further suggest that RNase G specifically

regulates mRNA degradation of some genes. DISCUSSION In this study, we report a genome-wide analysis of _S. maltophilia_ mRNA half-lives including nearly 50% of the genes of this

microorganism. We also propose a simple RT-qPCR-based method, modified from a previous study31, that might be applicable to other bacterial organisms, for the normalization of the

information derived from RNA-Seq analysis, using a highly expressed gene. Using this method, we estimated the mRNA half-lives of 2674 genes in _S. maltophilia_ D457 and 2449 genes in its

derived _rng_-deficient mutant ALB001. In previous studies with other microorganisms, validation of globally-analysed mRNA half-lives was usually performed by Northern blot analysis3,33,36.

However, in our method the correctness of the normalization procedure was verified by comparing the mRNA half-lives determined by RNA-Seq with mRNA half-lives determined by RT-qPCR for 4

independent genes (Table 3), which is a more robust approach for bacteria short-lived messengers. The parameters of the distribution of mRNA half-lives determined in this study were in the

range of those published for other microorganisms. The average of mRNA lifetimes determined by RNA-Seq for _E. coli_ in exponential phase was 2.5 min5, similar to our 2.88 min. In the

Gram-positive bacterium _Bacillus cereus_, a median of 2.4 and 2.6 min was reported for 2 strains respectively by a genome-wide RNA-Seq study, similar to our median of 2.74 min31.

_Sulfolobus_, which belongs to the archaea domain and is a much slower growing microorganism, presents median mRNA half-lives of 5 min29. Despite structural and physiological differences

among non-eukaryotic microorganisms, prokaryotic (and likely archaea) mRNA half-lives are rather similar among different taxa and the differences observed might, at least in occasions, be

caused by differences in the methodologies (RNA-Seq or hybridization to microarrays) used in the analysis3,30. Contrary to this situation eukaryotic mRNAs have longer half-lives36,37,38 than

prokaryotic ones. This situation likely reflects the time needed for transcript processing and transport outside the nucleus in eukaryotes as well as the need of prokaryotes for rapidly

reprogramming gene expression upon sudden changes in environmental changing conditions29. Multidrug efflux pumps are a paradigm of genes whose mRNAs are included in the same messenger

molecule forming an operon, however just few studies have reported the operon structure of other genes of less studied bacteria genomes as those of _S. maltophilia_ 25,39. We present here a

prediction of the operon structure of _S. maltophilia_ D457 based on proximity of CDS and expression values obtained by RNA-Seq. In accordance with our data, a _groESL_ operon was confirmed

previously based on sequence data and Northern blot analysis39. A _dnaK-dnaJ_ operon was also described and _grpE_ was discarded from being part of this operon due to promoter-like sequences

upstream of _grpE_ and _dnaK_ 2539; our analysis did not detect this operon. As expected, some RNAs from genes included in the same multi-gene operon have similar half-lives, but data are

not conclusive in all cases. Detailed studies of promoter sequences, transcription starting and termination sites are need to confirm the _S. maltophilia_ operon genome structure reported

here. Since the number of RNases in a cell is relatively low compared with the number of different mRNAs, it is possible that the decay of each mRNA is to some extent dictated by intrinsic

factors of the RNA molecule itself6 as G + C content31 or gene length. Further, since the decay of a mRNA molecule is a very regulated process, it was proposed that steady state gene

expression level itself is an important factor modulating the mRNA stability2,38,40. Notably, none of these factors seems to play a relevant role in _S. maltophilia_ mRNA half-lives (Fig. 

3), indicating that in this bacterial species regulation of mRNA stability could depend on other factors. Indeed, prior studies have shown that there is a correlation between gene function

and mRNA half-life for many organisms3,13,29,30,31,36,38, although the molecular basis for this mRNA behaviour are not known. For instance, transcripts of genes under the categories of amino

acid synthesis or macromolecule synthesis and modification have shorter half-lives than average, whereas those involved in cell envelope maintenance had longer-than-average half-lives3.

Also, genes involved in carbohydrates metabolism, in energy metabolism and in translation generally had longer half-lives,3,30,31. In our study, mRNAs of genes related to monosaccharide’s

metabolism presented shorter half-lives than others, while transcripts of genes encoding proteins of oxidative stress were found among the categories with the longest half-lives. Although

stress responses are usually fast and transient, bacteria were not subject to any stress condition in our experimental conditions, which might justify these results. It should be noted that

the different studies use different gene function classification schemes and hence comparisons are not always feasible. In addition, many _S. maltophilia_ genes are not unequivocally

annotated. Therefore, some categories are represented by just few genes precluding comparisons with other organisms. The inactivation of RNase G leads to minor changes in mRNA half-lives in

_E. coli_ 14. However, increasing RNase G expression in a RNase E-deficient _E. coli_ strain leads to a recovery of the decay of some, but not all of the mRNAs targeted by RNase E13.

Further, single amino acid changes in _E. coli_ RNase G complement RNase E deficient _E. coli_ mutants41. It then seems that RNase G, a paralog of RNase E, is requested in _E. coli_ to

process just some mRNAs, which are targets as well of RNase E. Different to this situation; since an overall increase of mRNA half-lives is evident in _rng_-deficient _S. maltophilia_

mutant, RNase G seems to have a much wider effect in _S. maltophilia_ mRNA stability than in _E. coli_. _E. coli_ strains deficient in genes encoding the exonuclease PNPase and the metabolic

enzyme enolase, and expressing a truncated C-terminal RNase E, which are three of the four main protein components of degradosome, overexpress _rng_, confirming functional complementarity

of RNase G with degradosome components42. We also detected that the lack of RNase G causes a variation in the overall _S. maltophilia_ mRNA half-lives, suggesting that mRNA decay becomes

less efficient when RNase G is absent, as the decay machinery cannot degrade mRNAs at their normal timing. Together, these data suggest that RNase G plays an important role in mRNA regulated

degradation in addition to the RNA degradosome. Beyond this global effect, some gene transcripts could be exclusively targeted by RNase G, since inactivation of _rng_ gene led to a large

increase in the half-lives of the mRNAs of several genes. Some of these genes are transcriptional regulators that regulate a diverse set of genes. The increase in mRNA stability of these

genes suggests that the turnover of these mRNAs may depend directly on RNase G, although more experiments are needed to verify the direct effect of RNase G over these RNAs. Lack of RNase G

could generate an indirect response in the expression of other ribonucleases, in a similar way as it was described in the case of RNase R in _P. putida_ 43 and with different RNases in _E.

coli_ 42, producing compensatory changes in the RNA decay machinery. These changes may facilitate normal growth despite not fully restored mRNA turnover, masking the identity of targets of

the ribonuclease. However, although the ALB001 mutant has normal growth compared with the wild-type strain18, our transcriptome analysis showed that none of the other _S. maltophilia_

ribonucleases was overexpressed when _rng_ is inactivated (Table 5). Therefore, the lack of RNase G is not compensated through the increased expression of another RNase in _S. maltophilia_.

CONCLUSIONS We report a method for the normalization and quantification of bacterial mRNAs derived from global transcriptomics data. This method has allowed us to globally analyse, for the

first time, the half-lives of the mRNAs of the relevant opportunistic pathogen _S. maltophilia_. In addition, we investigated the role that RNase G has in mRNA stability in this bacterial,

antibiotic resistant, pathogen. Together, we show that not only _S. maltophilia_ RNase G affects the stability of mRNAs of at least 40 genes, but also modulates at a global level the

stability of a large number of mRNAs in _S. maltophilia_. METHODS BACTERIAL GROWTH AND RNA ISOLATION The bacterial strains used in this work were _S. maltophilia_ D45744 and the _S.

maltophilia_ D457 _rng_-defective mutant ALB00118. Flasks containing 25 ml of LB medium were inoculated with overnight cultures of either _S. maltophilia_ D457 or ALB001 to 0.01 OD600 nm and

were subsequently grown at 37 °C, 250 rpm to mid-exponential phase (OD600 nm = 0.6). To synchronize the cultures, new flasks containing 25 ml of LB medium were inoculated with the

aforementioned cultures to 0.01 OD600 nm and grown again at 37 °C, 250 rpm to mid-exponential phase (OD600 nm = 0.6). A rifampicin run-out experiment was conducted as previously described18.

Two and a half millilitres of cultures (1/10) were inoculated in flasks containing 22,5 ml of prewarmed LB and at a final concentration of 200 μg/ml rifampicin. This concentration of

rifampicin was 4 times the minimal inhibitory concentration of this antibiotic against _S. maltophilia_ D457 as tested by using the broth dilution method. Each rifampicin-arrested sample was

used to extract RNA every five minutes. Five ml samples obtained at any given time were spun down for 20 min at 6,000 × _g_, 4 °C and pellets were immediately frozen on dry ice and stored

at −80 °C. Total RNA extraction, DNA elimination, RNA integrity verification and confirmation of DNA absence in the samples were performed as described previously45. Total RNA was extracted

and cleaned up from cell pellets using the RNeasy mini-kit (Qiagen) including the optional on-column DNase treatment according to the manufacturer’s instructions. To further eliminate any

remaining DNA, Turbo DNA-free (Ambion) was used. RNA concentration was measured by spectrophotometer (NanoDrop ND-1000). RNA integrity was verified on a 1% agarose gel, and the absence of

DNA was verified by PCR using _S. maltophilia_ specific primers Sme27 (5′ TGCCAGCGACAGTGCAAAGGGTC 3′) and Sme48 (5′ CCGTGTTCATGGAAGCAGGC 3′) that amplify a _S. maltophilia_ specific

region46. The experiment was carried out twice for each strain. CDNA SYNTHESIS AND RT-QPCR Complementary DNA generation and real-time PCR were performed as described previously45 with

modifications. Complementary DNA was obtained from 5 μg RNA (not depleted for rRNA) using a High Capacity cDNA reverse transcription (RT) kit (AB Applied Biosystems). Real -time PCR mixture

was obtained using the Power SYBR green kit (Applied Biosystems) as indicated by the manufacturer. Fifty ng of 10x diluted cDNA (for gene-specific primers) or 1 ng of 500x-diluted cDNA (for

16S rRNA primers) were included in 25 μl of qPCR reaction. The primers used in the RT-qPCR reaction are shown in Table 6. All primers were used in a final concentration of 200 nM, except for

rpoD1 and rpoD2 that were used at a final concentration of 500 nM. The reaction was performed as follows; a first denaturation step, 95 °C for 10 min, was followed by 40 cycles (95 °C for

15 s, 60 °C for 1 min). Differences in the relative amounts of mRNA for the different genes were determined according to the 2−∆CCT method47 and by using 1/50 diluted 16S rRNA levels of

expression for normalization. RNA-SEQ, CDNA LIBRARY PREPARATION AND SEQUENCING Duplicated RNAs from each strain and each time point were pooled to reduce biological variability (4 + 4 μg).

Sample concentration and integrity was checked in a Bioanalyzer 2100 (Agilent) (RIN > 8.2 all samples). RNA samples (3.5 µg each) were rRNA depleted with RiboZero (Epicentre), and rRNA

depletion of the recovered RNA was confirmed using Bioanalyzer 2100. RNA was then subjected to RNA library preparation using the Ultra Directional RNA Library Prep Kit (Cat no. E7420S, New

England Biolabs) following manufacturer recommendations. Libraries were pooled and fragments with lengths between 200 and 500 bp were purified from agarose gels. Remaining adapter dimers

were cleaned with AMPure XP beads (Beckman). Libraries were sequenced in a Miseq system (Illumina) using a v3 cartridge and a 150 bp, single-read format at the Parque Científico de Madrid.

INFORMATIC ANALYSIS OF SEQUENCES AND MRNA HALF-LIFE ANALYSIS To validate the rifampicin run-out experiment a RT-qPCR analysis was carried out with 2 genes presenting high expression levels

at exponential growth phase: _groEL_ and _groES_. Expression levels of these genes were calculated using the 2−∆CCT method47, mRNA half-lives (T1/2) were calculated from the equation T1/2 = 

ln(2)/µ, where the constant µ was calculated from the mean decay rate obtained by the logarithmic regression model adjustment of the expression data. Coefficients of correlation of the

expression data to the logarithmic regression model showing RNA decay were bigger than 0.98, confirming the suitable adjustment of the data. To calculate the half-lives of all mRNAs of _S.

maltophilia_ D457 and ALB001, data of deep sequencing were used. Raw data from deep sequencing were trimmed, filtered by quality, mapped and indexed against the reference genome SMD457, with

accession number HE79855617. The trimming and the quality filtering was performed using Fastq_trimmer and Alien_trimmer. The procedure consisted of removing the first 10 bp of all

sequences, removing adapters (with no mismatches and with at least 10 bp), removing reads shorter than 30 bp and keeping reads with at least 28 of _c_ quality. The fastq data files obtained

from trimmed and filtered RNA deep sequencing data were analysed using Rockhopper software to map reads against the reference genome SMD457 and to obtain the values of gene expression. The

bam archives were obtained mapping reads against reference genome with Bowtie version 0.11.3. To compare gene expression levels of different genes, the RNA-sequencing data were normalized as

the total number of reads mapped to a CDS, and divided by the length of the CDS in kilobases (RPK: reads per kilobase). Values are generally normalized by the total number of unambiguously

mapped reads in each sample, giving the value of RPKM48. Expression values obtained by Rockhopper for each transcript in each condition are similar to RPKM, but the expression levels are

normalized by the upper quartile of gene expression, which is a more robust normalization approach. Since all expression data were analysed using this program and because results are

equivalent for each kind of normalization in all cases, we have named as RPKM to the normalized values of expression obtained using Rockhopper. To adjust for unequal amounts of cDNA in each

sample and the expected fall in mRNA expression levels during the 15 minutes time-course, as well as for eliminating the putative bias due to potentially variable efficiency of rRNA

depletion, the following procedure was carried out for normalization. Any rRNA remains and any ncRNA data were excluded from the analysis. Genes with RPKM data at t0 < 15 were excluded

from the analysis. Since no rRNA is present in RNA samples subjected to deep sequencing, 16S rRNA could not be used for normalization. To normalize expression data of samples from different

time points, data from _groES_ RT-qPCR during the 15 min after rifampicin addition were used to calculate the expected values of _groES_ mRNA decay from expression data of deep sequencing31.

Afterwards, these _groES_ expression data were used to normalize the expression data of all other genes. The µ statistic used to calculate the half-life of each CDS and the coefficient of

the degree of the adjustment of the data (R2) were obtained by fitting the data into a logarithmic regression model. The output mRNA half-lives of genes which logarithmic regression

adjustment of the data that had a R2 > 0.7 were considered. By using this approach, it was possible to determine the mRNA half-lives of 2674 genes for the D457 strain, and 2449 for the

ALB001 strain. To validate mRNA half-lives calculation procedure, mRNA half-lives were determined by RT-qPCR for 4 independent genes, which levels of expression in exponential growth phase

were bigger than 300 RPKM (_groEL_, _rpoD_, _gyrA_ and _ftsZ_)18, by using _S. maltophilia_ D457 non-rRNA depleted samples from time points t0, t5, t10 and t15. PREDICTION OF OPERONS

Rockhopper software has a tool to predict multi-gene operon. To estimate the probability that consecutive genes on the same strand are co-transcribed as part of a multi-gene operon, two

features are taking into account: the distance in nucleotides between the genes and the similarity of the gene expression in the RNA-Seq data. RNA-SEQ DATA ACCESSION NUMBER The RNA-Seq data

described in this article were deposited in the GEO (Gene Expression Omnibus) database of NCBI (accession number GSE103467). AVAILABILITY OF DATA AND MATERIAL The datasets generated during

the current study are included in this published article (and its Supplementary Information files). REFERENCES * Perez-Ortin, J. E., Alepuz, P. M. & Moreno, J. Genomics and gene

transcription kinetics in yeast. _Trends Genet_ 23, 250–257 (2007). Article  CAS  PubMed  Google Scholar  * Keene, J. D. The global dynamics of RNA stability orchestrates responses to

cellular activation. _BMC Biol_ 8, 95 (2010). Article  PubMed  PubMed Central  CAS  Google Scholar  * Bernstein, J. A., Khodursky, A. B., Lin, P. H., Lin-Chao, S. & Cohen, S. N. Global

analysis of mRNA decay and abundance in _Escherichia coli_ at single-gene resolution using two-color fluorescent DNA microarrays. _Proc Natl Acad Sci USA_ 99, 9697–9702 (2002). Article  CAS

  PubMed  PubMed Central  ADS  Google Scholar  * Wurtzel, O. _et al_. A single-base resolution map of an archaeal transcriptome. _Genome research_ 20, 133–141 (2010). Article  CAS  PubMed 

PubMed Central  Google Scholar  * Chen, H., Shiroguchi, K., Ge, H. & Xie, X. S. Genome-wide study of mRNA degradation and transcript elongation in _Escherichia coli_. _Mol Syst Biol_ 11,

781 (2015). Article  PubMed  PubMed Central  CAS  Google Scholar  * Hambraeus, G., von Wachenfeldt, C. & Hederstedt, L. Genome-wide survey of mRNA half-lives in _Bacillus subtilis_

identifies extremely stable mRNAs. _Mol Genet Genomics_ 269, 706–714 (2003). Article  CAS  PubMed  Google Scholar  * Kushner, S. R. mRNA decay in prokaryotes and eukaryotes: different

approaches to a similar problem. _IUBMB Life_ 56, 585–594 (2004). Article  CAS  PubMed  Google Scholar  * Carpousis, A. J. The _Escherichia coli_ RNA degradosome: structure, function and

relationship in other ribonucleolytic multienzyme complexes. _Biochem Soc Trans_ 30, 150–155 (2002). Article  CAS  PubMed  Google Scholar  * Mackie, G. A. RNase E: at the interface of

bacterial RNA processing and decay. _Nature reviews. Microbiology_ 11, 45–57 (2013). Article  CAS  PubMed  Google Scholar  * Drider, D. & Condon, C. The continuing story of

endoribonuclease III. _J Mol Microbiol Biotechnol_ 8, 195–200 (2004). Article  PubMed  CAS  Google Scholar  * Ito, R. & Ohnishi, Y. The roles of RNA polymerase and RNAase I in stable RNA

degradation in _Escherichia coli_ carrying the _srnB+_ gene. _Biochim Biophys Acta_ 739, 27–34 (1983). Article  CAS  PubMed  Google Scholar  * Umitsuki, G., Wachi, M., Takada, A., Hikichi,

T. & Nagai, K. Involvement of RNase G in _in vivo_ mRNA metabolism in _Escherichia coli_. _Genes Cells_ 6, 403–410 (2001). Article  CAS  PubMed  Google Scholar  * Lee, K., Bernstein, J.

A. & Cohen, S. N. RNase G complementation of _rne_ null mutation identifies functional interrelationships with RNase E in _Escherichia coli_. _Mol Microbiol_ 43 (2002). * Ow, M. C.,

Perwez, T. & Kushner, S. R. RNase G of _Escherichia coli_ exhibits only limited functional overlap with its essential homologue, RNase E. _Mol Microbiol_ 49, 607–622 (2003). Article  CAS

  PubMed  Google Scholar  * Richards, J. & Belasco, J. G. Distinct Requirements for 5′-Monophosphate-assisted RNA Cleavage by _Escherichia coli_ RNase E and RNase G. _J Biol Chem_ 291,

5038–5048 (2016). Article  CAS  PubMed  Google Scholar  * Eidem, T. M., Roux, C. M. & Dunman, P. M. RNA decay: a novel therapeutic target in bacteria. _Wiley Interdiscip Rev RNA_ 3,

443–454 (2012). Article  CAS  PubMed  PubMed Central  Google Scholar  * Lira, F. _et al_. Whole-genome sequence of _Stenotrophomonas maltophilia_ D457, a clinical isolate and a model strain.

_J Bacteriol_ 194, 3563–3564 (2012). Article  CAS  PubMed  PubMed Central  Google Scholar  * Bernardini, A., Corona, F., Dias, R., Sanchez, M. B. & Martinez, J. L. The inactivation of

RNase G reduces the _Stenotrophomonas maltophilia_ susceptibility to quinolones by triggering the heat shock response. _Front Microbiol_ 6, 1068 (2015). Article  PubMed  PubMed Central 

Google Scholar  * Brooke, J. S. _Stenotrophomonas maltophilia_: an emerging global opportunistic pathogen. _Clin Microbiol Rev_ 25, 2–41 (2012). Article  CAS  PubMed  PubMed Central  ADS 

Google Scholar  * Walsh, T. R., MacGowan, A. P. & Bennett, P. M. Sequence analysis and enzyme kinetics of the L2 serine beta-lactamase from _Stenotrophomonas maltophilia_. _Antimicrob

Agents Chemother_ 41, 1460–1464 (1997). CAS  PubMed  PubMed Central  Google Scholar  * Lambert, T., Ploy, M. C., Denis, F. & Courvalin, P. Characterization of the chromosomal

_aac(6′)-Iz_ gene of _Stenotrophomonas maltophilia_. _Antimicrob Agents Chemother_ 43, 2366–2371 (1999). CAS  PubMed  PubMed Central  Google Scholar  * Alonso, A. & Martinez, J. L.

Cloning and characterization of SmeDEF, a novel multidrug efflux pump from _Stenotrophomonas maltophilia_. _Antimicrob Agents Chemother_ 44, 3079–3086 (2000). Article  CAS  PubMed  PubMed

Central  Google Scholar  * Avison, M. B. _et al_. Differential regulation of L1 and L2 beta-lactamase expression in _Stenotrophomonas maltophilia_. _The Journal of antimicrobial

chemotherapy_ 49, 387–389 (2002). Article  CAS  PubMed  Google Scholar  * Okazaki, A. & Avison, M. B. Aph(3′)-IIc, an aminoglycoside resistance determinant from _Stenotrophomonas

maltophilia_. _Antimicrob Agents Chemother_ 51, 359–360 (2007). Article  CAS  PubMed  Google Scholar  * Crossman, L. C. _et al_. The complete genome, comparative and functional analysis of

_Stenotrophomonas maltophilia_ reveals an organism heavily shielded by drug resistance determinants. _Genome biology_ 9, R74 (2008). Article  PubMed  PubMed Central  CAS  Google Scholar  *

Sanchez, M. B., Hernandez, A., Rodriguez-Martinez, J. M., Martinez-Martinez, L. & Martinez, J. L. Predictive analysis of transmissible quinolone resistance indicates _Stenotrophomonas

maltophilia_ as a potential source of a novel family of Qnr determinants. _BMC microbiology_ 8, 148 (2008). Article  PubMed  PubMed Central  CAS  Google Scholar  * Shimizu, K. _et al_.

Sm_qnr_, a new chromosome-carried quinolone resistance gene in _Stenotrophomonas maltophilia_. _Antimicrob Agents Chemother_ 52, 3823–3825 (2008). Article  CAS  PubMed  PubMed Central 

Google Scholar  * Garcia-Leon, G., Salgado, F., Oliveros, J. C., Sanchez, M. B. & Martinez, J. L. Interplay between intrinsic and acquired resistance to quinolones in _Stenotrophomonas

maltophilia_. _Environmental microbiology_ (2014). * Andersson, A. F. _et al_. Global analysis of mRNA stability in the archaeon Sulfolobus. _Genome biology_ 7, R99 (2006). Article  PubMed 

PubMed Central  CAS  Google Scholar  * Selinger, D. W., Saxena, R. M., Cheung, K. J., Church, G. M. & Rosenow, C. Global RNA half-life analysis in _Escherichia coli_ reveals positional

patterns of transcript degradation. _Genome research_ 13, 216–223 (2003). Article  CAS  PubMed  PubMed Central  Google Scholar  * Kristoffersen, S. M. _et al_. Global mRNA decay analysis at

single nucleotide resolution reveals segmental and positional degradation patterns in a Gram-positive bacterium. _Genome biology_ 13 (2012). * Ignatov, D. V. _et al_. Dormant non-culturable

_Mycobacterium tuberculosis_ retains stable low-abundant mRNA. _BMC genomics_ 16, 954 (2015). Article  PubMed  PubMed Central  CAS  Google Scholar  * Liu, B. _et al_. Global analysis of mRNA

decay intermediates in _Bacillus subtilis_ wild-type and polynucleotide phosphorylase-deletion strains. _Mol Microbiol_ 94, 41–55 (2014). Article  CAS  PubMed  PubMed Central  Google

Scholar  * Hartmann, G., Honikel, K. O., Knusel, F. & Nuesch, J. The specific inhibition of the DNA-directed RNA synthesis by rifamycin. _Biochim Biophys Acta_ 145, 843–844 (1967).

Article  CAS  PubMed  Google Scholar  * Lira, F., Berg, G. & Martinez, J. L. Double-face meets the bacterial world: the opportunistic pathogen _Stenotrophomonas maltophilia_. _Front

Microbiol_ 8, 2190 (2017). * Wang, Y. _et al_. Precision and functional specificity in mRNA decay. _Proc Natl Acad Sci USA_ 99, 5860–5865 (2002). * Lam, L. T. _et al_. Genomic-scale

measurement of mRNA turnover and the mechanisms of action of the anti-cancer drug flavopiridol. _Genome biology_ 2, RESEARCH0041 (2001). Article  CAS  PubMed  PubMed Central  ADS  Google

Scholar  * Yang, E. _et al_. Decay rates of human mRNAs: correlation with functional characteristics and sequence attributes. _Genome research_ 13, 1863–1872 (2003). Article  CAS  PubMed 

PubMed Central  Google Scholar  * De Carolis, E. _et al_. Analysis of heat-induced changes in protein expression of _Stenotrophomonas maltophilia_ K279a reveals a role for GroEL in the

host-temperature adaptation. _Int J Med Microbiol_ 301, 273–281 (2011). Article  PubMed  CAS  Google Scholar  * Papenfort, K. & Vogel, J. Multiple target regulation by small noncoding

RNAs rewires gene expression at the post-transcriptional level. _Res Microbiol_ 160, 278–287 (2009). Article  CAS  PubMed  Google Scholar  * Chung, D. H., Min, Z., Wang, B. C. & Kushner,

S. R. Single amino acid changes in the predicted RNase H domain of _Escherichia coli_ RNase G lead to complementation of RNase E deletion mutants. _RNA_ 16, 1371–1385 (2010). Article  CAS 

PubMed  PubMed Central  Google Scholar  * Zhou, L., Zhang, A. B., Wang, R., Marcotte, E. M. & Vogel, C. The proteomic response to mutants of the _Escherichia coli_ RNA degradosome.

_Molecular bioSystems_ 9, 750–757 (2013). Article  CAS  PubMed  PubMed Central  Google Scholar  * Fonseca, P., Moreno, R. & Rojo, F. Genomic analysis of the role of RNase R in the

turnover of _Pseudomonas putida_ mRNAs. _J Bacteriol_ 190, 6258–6263 (2008). Article  CAS  PubMed  PubMed Central  Google Scholar  * Alonso, A. & Martinez, J. L. Multiple antibiotic

resistance in _Stenotrophomonas maltophilia_. _Antimicrob Agents Chemother_ 41, 1140–1142 (1997). CAS  PubMed  PubMed Central  Google Scholar  * Olivares, J. _et al_. Overproduction of the

multidrug efflux pump MexEF-OprN does not impair _Pseudomonas aeruginosa_ fitness in competition tests, but produces specific changes in bacterial regulatory networks. _Environmental

microbiology_ 14, 1968–1981 (2012). Article  CAS  PubMed  Google Scholar  * Sanchez, P., Alonso, A. & Martinez, J. L. Cloning and characterization of SmeT, a repressor of the

_Stenotrophomonas maltophilia_ multidrug efflux pump SmeDEF. _Antimicrob Agents Chemother_ 46, 3386–3393 (2002). Article  CAS  PubMed  PubMed Central  Google Scholar  * Livak, K. J. &

Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. _Methods_ 25, 402–408 (2001). Article  CAS  PubMed  Google

Scholar  * Mortazavi, A., Williams, B. A., McCue, K., Schaeffer, L. & Wold, B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. _Nat Methods_ 5, 621–628 (2008). Article  CAS

  PubMed  Google Scholar  * Hernandez, A., Ruiz, F. M., Romero, A. & Martinez, J. L. The binding of triclosan to SmeT, the repressor of the multidrug efflux pump SmeDEF, induces

antibiotic resistance in _Stenotrophomonas maltophilia_. _PLoS Pathog_ 7, e1002103 (2011). Article  CAS  PubMed  PubMed Central  Google Scholar  * Sanchez, M. B. & Martinez, J. L. SmQnr

contributes to intrinsic resistance to quinolones in _Stenotrophomonas maltophilia_. _Antimicrob Agents Chemother_ 54, 580–581 (2010). Article  CAS  PubMed  Google Scholar  * Yang, T. C.,

Huang, Y. W., Hu, R. M., Huang, S. C. & Lin, Y. T. AmpDI is involved in expression of the chromosomal L1 and L2 beta-lactamases of Stenotrophomonas maltophilia. _Antimicrob Agents

Chemother_ 53, 2902–2907 (2009). Article  CAS  PubMed  PubMed Central  Google Scholar  Download references ACKNOWLEDGEMENTS Work in our laboratory is supported by grants from the Instituto

de Salud Carlos III (Spanish Network for Research on Infectious Diseases [RD16/0016/0011]) and from the Spanish Ministry of Economy and Competitivity (BIO2014-54507-R and JPI Water StARE

JPIW2013-089-C02-01). AB has been a recipient of a La Caixa fellowship. AUTHOR INFORMATION AUTHORS AND AFFILIATIONS * Centro Nacional de Biotecnología, CSIC, Darwin 3, 28049, Madrid, Spain

Alejandra Bernardini & José L. Martínez Authors * Alejandra Bernardini View author publications You can also search for this author inPubMed Google Scholar * José L. Martínez View author

publications You can also search for this author inPubMed Google Scholar CONTRIBUTIONS A.B. and J.L.M. contributed to the design of the study, to the analysis of the results and to write

the manuscript. A.B. performed the experiments reported in the manuscript. Both authors read and approved the final manuscript. CORRESPONDING AUTHORS Correspondence to Alejandra Bernardini

or José L. Martínez. ETHICS DECLARATIONS COMPETING INTERESTS The authors declare that they have no competing interests. ADDITIONAL INFORMATION PUBLISHER'S NOTE: Springer Nature remains

neutral with regard to jurisdictional claims in published maps and institutional affiliations. ELECTRONIC SUPPLEMENTARY MATERIAL SUPPLEMENTAL MATERIAL RIGHTS AND PERMISSIONS OPEN ACCESS This

article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as

you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party

material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s

Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.

To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Reprints and permissions ABOUT THIS ARTICLE CITE THIS ARTICLE Bernardini, A., Martínez, J.L. Genome-wide

analysis shows that RNase G plays a global role in the stability of mRNAs in _Stenotrophomonas maltophilia_ . _Sci Rep_ 7, 16016 (2017). https://doi.org/10.1038/s41598-017-16091-0 Download

citation * Received: 16 June 2017 * Accepted: 07 November 2017 * Published: 22 November 2017 * DOI: https://doi.org/10.1038/s41598-017-16091-0 SHARE THIS ARTICLE Anyone you share the

following link with will be able to read this content: Get shareable link Sorry, a shareable link is not currently available for this article. Copy to clipboard Provided by the Springer

Nature SharedIt content-sharing initiative